EMAIL THIS PAGE TO A FRIEND

NEUROD1

neuronal differentiation 1

170 Gene Product Result for
Synonyms: BETA2 BHF-1 MODY6 NEUROD bHLHa3
Gene ID:
Human(4760) Summary: This gene encodes a member of the NeuroD family of basic helix-loop-helix (bHLH) transcription factors. The protein forms heterodimers with other bHLH proteins and activates transcription of genes that contain a specific DNA sequence known as the E-box. It regulates expression of the insulin gene, and mutations in this gene result in type II diabetes mellitus. [provided by RefSeq, Jul 2008]
Mouse(18012) neurogenic differentiation 1
Rat(29458) neuronal differentiation 1
chicken(395754) neurogenic differentiation 1
dog(488431) neuronal differentiation 1
domestic cat(101081998) neuronal differentiation 1
cow(539487) neurogenic differentiation 1
naked mole-rat(101710071) neuronal differentiation 1
domestic guinea pig(100717228) neuronal differentiation 1
sheep(554337) neuronal differentiation 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
N3663 Anti-NeuroD1 antibody produced in rabbit ~1 mg/mL, affinity isolated antibody, buffered aqueous solution rat, mouse, human
western blot pricing
SAB2107881 Anti-NEUROD1 antibody produced in rabbit IgG fraction of antiserum pig, horse, mouse, rat, bovine, human, guinea pig
western blot pricing
HPA003278 Anti-NEUROD1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
AV32036 Anti-NEUROD1 antibody produced in rabbit IgG fraction of antiserum, lyophilized powder canine, rat, human, mouse, bovine
western blot pricing
SAB2101572 Anti-NEUROD1 antibody produced in rabbit affinity isolated antibody rat, human, guinea pig, horse, mouse, bovine, zebrafish,
western blot pricing
SAB4504716 Anti-phospho-Neuro D (pSer274) antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, western blot pricing
SAB4301366 Anti-phospho-Neuro D (pSer274) antibody produced in rabbit affinity isolated antibody rat, human, mouse
western blot pricing
WH0004760M1 Monoclonal Anti-NEUROD1 antibody produced in mouse clone 3H8, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1404119 Monoclonal Anti-NEUROD1 antibody produced in mouse clone 3D11, purified immunoglobulin, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002500 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002500 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002500 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010894 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010894 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010894 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002500 Rosetta Predictions human pricing
NM_019218 Rosetta Predictions rat pricing
NM_010894 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002500 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00062895 predicted 1161
2 SASI_Hs01_00062896 predicted 1232
3 SASI_Hs01_00062897 predicted 1230
4 SASI_Hs01_00062898 predicted 1245
5 SASI_Hs01_00062899 predicted 1178
6 SASI_Hs01_00062900 predicted 937
7 SASI_Hs01_00062901 predicted 791
8 SASI_Hs01_00062902 predicted 939
9 SASI_Hs01_00062903 predicted 1129
10 SASI_Hs01_00062904 predicted 1247
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019218 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00035241 predicted 1437
2 SASI_Rn01_00035242 predicted 1296
3 SASI_Rn01_00035243 predicted 1073
4 SASI_Rn01_00035244 predicted 1513
5 SASI_Rn01_00035245 predicted 1511
6 SASI_Rn01_00035247 predicted 1259
7 SASI_Rn01_00035248 predicted 1154
8 SASI_Rn01_00035249 predicted 1423
9 SASI_Rn01_00035250 predicted 521
10 SASI_Rn02_00262070 predicted 1267
11 SASI_Rn01_00035246 predicted 1444
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010894 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00082459 predicted 952
2 SASI_Mm02_00319605 predicted 1134
3 SASI_Mm01_00082460 predicted 1212
4 SASI_Mm01_00082461 predicted 1185
5 SASI_Mm01_00082462 predicted 1078
6 SASI_Mm01_00082463 predicted 555
7 SASI_Mm01_00082464 predicted 1199
8 SASI_Mm01_00082465 predicted 1156
9 SASI_Mm01_00082466 predicted 1104
10 SASI_Mm01_00082467 predicted 1112
11 SASI_Mm01_00082468 predicted 1266
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002500
NEUROD1 MISSION shRNA Bacterial Glycerol Stock
neuronal differentiation 1
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000428368    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002500.2-1579s21c1
Sequence:CCGGGCTGTATTCAGATCGTATTAACTCGAGTTAATACGATCTGAATACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419479    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002500.2-1418s21c1
Sequence:CCGGCCAAGCTTCAAGTGATATATGCTCGAGCATATATCACTTGAAGCTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019859    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002500.1-1860s1c1
Sequence:CCGGGCACAATTTGAGCAATTCATTCTCGAGAATGAATTGCTCAAATTGTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002500.1-493s1c1
Sequence:CCGGGCCTTGCTATTCTAAGACGCACTCGAGTGCGTCTTAGAATAGCAAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002500.1-1100s1c1
Sequence:CCGGGACAATATTATGTCCTTCGATCTCGAGATCGAAGGACATAATATTGTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002500.1-1154s1c1
Sequence:CCGGCAGCTCAATGCCATATTTCATCTCGAGATGAAATATGGCATTGAGCTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002500
NEUROD1 MISSION shRNA shRNA Plasmid DNA
neuronal differentiation 1
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000428368    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002500.2-1579s21c1
Sequence:CCGGGCTGTATTCAGATCGTATTAACTCGAGTTAATACGATCTGAATACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419479    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002500.2-1418s21c1
Sequence:CCGGCCAAGCTTCAAGTGATATATGCTCGAGCATATATCACTTGAAGCTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019859    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002500.1-1860s1c1
Sequence:CCGGGCACAATTTGAGCAATTCATTCTCGAGAATGAATTGCTCAAATTGTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002500.1-493s1c1
Sequence:CCGGGCCTTGCTATTCTAAGACGCACTCGAGTGCGTCTTAGAATAGCAAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002500.1-1100s1c1
Sequence:CCGGGACAATATTATGTCCTTCGATCTCGAGATCGAAGGACATAATATTGTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002500.1-1154s1c1
Sequence:CCGGCAGCTCAATGCCATATTTCATCTCGAGATGAAATATGGCATTGAGCTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002500
NEUROD1 MISSION shRNA Lentiviral Transduction Particles
neuronal differentiation 1
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000428368    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002500.2-1579s21c1
Sequence:CCGGGCTGTATTCAGATCGTATTAACTCGAGTTAATACGATCTGAATACAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419479    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002500.2-1418s21c1
Sequence:CCGGCCAAGCTTCAAGTGATATATGCTCGAGCATATATCACTTGAAGCTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019859    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002500.1-1860s1c1
Sequence:CCGGGCACAATTTGAGCAATTCATTCTCGAGAATGAATTGCTCAAATTGTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002500.1-493s1c1
Sequence:CCGGGCCTTGCTATTCTAAGACGCACTCGAGTGCGTCTTAGAATAGCAAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002500.1-1100s1c1
Sequence:CCGGGACAATATTATGTCCTTCGATCTCGAGATCGAAGGACATAATATTGTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002500.1-1154s1c1
Sequence:CCGGCAGCTCAATGCCATATTTCATCTCGAGATGAAATATGGCATTGAGCTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010894
NEUROD1 MISSION shRNA Bacterial Glycerol Stock
neuronal differentiation 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000218693    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010894.2-932s21c1
Sequence:GTACCGGATCAATGGCAACTTCTCTTTCCTCGAGGAAAGAGAAGTTGCCATTGATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000225955    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010894.2-1446s21c1
Sequence:CCGGGCTGTATTCAGATCGTATTAACTCGAGTTAATACGATCTGAATACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000225954    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010894.2-1166s21c1
Sequence:CCGGGATTAGAGGCACGTCAGTTTCCTCGAGGAAACTGACGTGCCTCTAATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257289    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010894.2-219s21c1
Sequence:CCGGACGAGCTTGAAGCCATGAATGCTCGAGCATTCATGGCTTCAAGCTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081773    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010894.1-1786s1c1
Sequence:CCGGGCGTTGCCTTAGCACTTCTTTCTCGAGAAAGAAGTGCTAAGGCAACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081775    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010894.1-926s1c1
Sequence:CCGGGCTCAGCATCAATGGCAACTTCTCGAGAAGTTGCCATTGATGCTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010894.1-1036s1c1
Sequence:CCGGGCCACGGATCAATCTTCTCTTCTCGAGAAGAGAAGATTGATCCGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010894.1-219s1c1
Sequence:CCGGGACGAGCTTGAAGCCATGAATCTCGAGATTCATGGCTTCAAGCTCGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010894.1-1092s1c1
Sequence:CCGGGACAACATTATGTCTTTCGATCTCGAGATCGAAAGACATAATGTTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010894
NEUROD1 MISSION shRNA shRNA Plasmid DNA
neuronal differentiation 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000218693    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010894.2-932s21c1
Sequence:GTACCGGATCAATGGCAACTTCTCTTTCCTCGAGGAAAGAGAAGTTGCCATTGATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000225955    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010894.2-1446s21c1
Sequence:CCGGGCTGTATTCAGATCGTATTAACTCGAGTTAATACGATCTGAATACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000225954    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010894.2-1166s21c1
Sequence:CCGGGATTAGAGGCACGTCAGTTTCCTCGAGGAAACTGACGTGCCTCTAATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257289    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010894.2-219s21c1
Sequence:CCGGACGAGCTTGAAGCCATGAATGCTCGAGCATTCATGGCTTCAAGCTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081773    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010894.1-1786s1c1
Sequence:CCGGGCGTTGCCTTAGCACTTCTTTCTCGAGAAAGAAGTGCTAAGGCAACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081775    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010894.1-926s1c1
Sequence:CCGGGCTCAGCATCAATGGCAACTTCTCGAGAAGTTGCCATTGATGCTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010894.1-1036s1c1
Sequence:CCGGGCCACGGATCAATCTTCTCTTCTCGAGAAGAGAAGATTGATCCGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010894.1-219s1c1
Sequence:CCGGGACGAGCTTGAAGCCATGAATCTCGAGATTCATGGCTTCAAGCTCGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010894.1-1092s1c1
Sequence:CCGGGACAACATTATGTCTTTCGATCTCGAGATCGAAAGACATAATGTTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010894
NEUROD1 MISSION shRNA Lentiviral Transduction Particles
neuronal differentiation 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000218693    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010894.2-932s21c1
Sequence:GTACCGGATCAATGGCAACTTCTCTTTCCTCGAGGAAAGAGAAGTTGCCATTGATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000225955    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010894.2-1446s21c1
Sequence:CCGGGCTGTATTCAGATCGTATTAACTCGAGTTAATACGATCTGAATACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000225954    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010894.2-1166s21c1
Sequence:CCGGGATTAGAGGCACGTCAGTTTCCTCGAGGAAACTGACGTGCCTCTAATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257289    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010894.2-219s21c1
Sequence:CCGGACGAGCTTGAAGCCATGAATGCTCGAGCATTCATGGCTTCAAGCTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081773    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010894.1-1786s1c1
Sequence:CCGGGCGTTGCCTTAGCACTTCTTTCTCGAGAAAGAAGTGCTAAGGCAACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081775    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010894.1-926s1c1
Sequence:CCGGGCTCAGCATCAATGGCAACTTCTCGAGAAGTTGCCATTGATGCTGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010894.1-1036s1c1
Sequence:CCGGGCCACGGATCAATCTTCTCTTCTCGAGAAGAGAAGATTGATCCGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010894.1-219s1c1
Sequence:CCGGGACGAGCTTGAAGCCATGAATCTCGAGATTCATGGCTTCAAGCTCGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010894.1-1092s1c1
Sequence:CCGGGACAACATTATGTCTTTCGATCTCGAGATCGAAAGACATAATGTTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)