EMAIL THIS PAGE TO A FRIEND

NEUROD2

neuronal differentiation 2

148 Gene Product Result for
Synonyms: NDRF bHLHa1
UniProtKB ID: Q15784, Q8TBI7, Q9UQC6
Gene ID:
Human(4761) Summary: This gene encodes a member of the neuroD family of neurogenic basic helix-loop-helix (bHLH) proteins. Expression of this gene can induce transcription from neuron-specific promoters, such as the GAP-43 promoter, which contain a specific DNA sequence known as an E-box. The product of the human gene can induce neurogenic differentiation in non-neuronal cells in Xenopus embryos, and is thought to play a role in the determination and maintenance of neuronal cell fates. [provided by RefSeq, Jul 2008]
Mouse(18013) neurogenic differentiation 2
Rat(54276) neuronal differentiation 2
domestic guinea pig(100723910) neuronal differentiation 2
naked mole-rat(101709326) neuronal differentiation 2
Zebrafish(114435) neurogenic differentiation 2
dog(491026) neuronal differentiation 2
cow(528817) neurogenic differentiation 2
domestic cat(101101096) neuronal differentiation 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010895 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010895 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010895 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006160 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006160 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006160 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006160 Rosetta Predictions human pricing
NM_019326 Rosetta Predictions rat pricing
NM_010895 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006160 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00018644 predicted 683
2 SASI_Hs01_00018645 predicted 683
3 SASI_Hs01_00018646 predicted 682
4 SASI_Hs01_00018647 predicted 730
5 SASI_Hs01_00018649 predicted 1719
6 SASI_Hs01_00018650 predicted 689
7 SASI_Hs01_00018651 predicted 732
8 SASI_Hs02_00341009 predicted 1762
9 SASI_Hs02_00341010 predicted 507
10 SASI_Hs01_00018652 predicted 492
11 SASI_Hs01_00018648 predicted 1218
12 SASI_Hs01_00018653 predicted 1267
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019326 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00068789 predicted 650
2 SASI_Rn01_00068790 predicted 611
3 SASI_Rn01_00068791 predicted 883
4 SASI_Rn01_00068792 predicted 1083
5 SASI_Rn01_00068793 predicted 727
6 SASI_Rn01_00068794 predicted 657
7 SASI_Rn01_00068795 predicted 898
8 SASI_Rn01_00068796 predicted 982
9 SASI_Rn01_00068797 predicted 1103
10 SASI_Rn01_00068798 predicted 700
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010895 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00319606 predicted 843
2 SASI_Mm01_00042975 predicted 923
3 SASI_Mm01_00042982 predicted 848
4 SASI_Mm01_00042978 predicted 1081
5 SASI_Mm01_00042979 predicted 1098
6 SASI_Mm02_00319607 predicted 1285
7 SASI_Mm02_00319608 predicted 717
8 SASI_Mm02_00319609 predicted 1175
9 SASI_Mm02_00319610 predicted 838
10 SASI_Mm02_00319611 predicted 1293
11 SASI_Mm01_00042974 predicted 1021
12 SASI_Mm01_00042976 predicted 1087
13 SASI_Mm01_00042977 predicted 1083
14 SASI_Mm01_00042980 predicted 931
15 SASI_Mm01_00042981 predicted 821
16 SASI_Mm01_00042983 predicted 1050
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010895
NEUROD2 MISSION shRNA Bacterial Glycerol Stock
neuronal differentiation 2
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000081824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010895.2-856s1c1
Sequence:CCGGGCAGTTAAACTCTCGTAACTTCTCGAGAAGTTACGAGAGTTTAACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010895.2-1316s1c1
Sequence:CCGGGATATGCACCTTCACCACGATCTCGAGATCGTGGTGAAGGTGCATATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081823    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010895.2-1652s1c1
Sequence:CCGGCCAAGAGACTTCCTCCACATTCTCGAGAATGTGGAGGAAGTCTCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010895.2-1138s1c1
Sequence:CCGGGCTCTGTCTCAACGGCAACTTCTCGAGAAGTTGCCGTTGAGACAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427839    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010895.3-1337s21c1
Sequence:CCGGTACGAGGAGCTCAACGCATTTCTCGAGAAATGCGTTGAGCTCCTCGTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427190    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010895.3-1863s21c1
Sequence:CCGGGCCTTCACCCTAACACGAATCCTCGAGGATTCGTGTTAGGGTGAAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413970    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010895.3-844s21c1
Sequence:CCGGGCAGCTAAACTCTCGTAACTTCTCGAGAAGTTACGAGAGTTTAGCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010895
NEUROD2 MISSION shRNA shRNA Plasmid DNA
neuronal differentiation 2
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000081824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010895.2-856s1c1
Sequence:CCGGGCAGTTAAACTCTCGTAACTTCTCGAGAAGTTACGAGAGTTTAACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010895.2-1316s1c1
Sequence:CCGGGATATGCACCTTCACCACGATCTCGAGATCGTGGTGAAGGTGCATATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081823    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010895.2-1652s1c1
Sequence:CCGGCCAAGAGACTTCCTCCACATTCTCGAGAATGTGGAGGAAGTCTCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010895.2-1138s1c1
Sequence:CCGGGCTCTGTCTCAACGGCAACTTCTCGAGAAGTTGCCGTTGAGACAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427839    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010895.3-1337s21c1
Sequence:CCGGTACGAGGAGCTCAACGCATTTCTCGAGAAATGCGTTGAGCTCCTCGTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427190    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010895.3-1863s21c1
Sequence:CCGGGCCTTCACCCTAACACGAATCCTCGAGGATTCGTGTTAGGGTGAAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413970    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010895.3-844s21c1
Sequence:CCGGGCAGCTAAACTCTCGTAACTTCTCGAGAAGTTACGAGAGTTTAGCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010895
NEUROD2 MISSION shRNA Lentiviral Transduction Particles
neuronal differentiation 2
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000081824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010895.2-856s1c1
Sequence:CCGGGCAGTTAAACTCTCGTAACTTCTCGAGAAGTTACGAGAGTTTAACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010895.2-1316s1c1
Sequence:CCGGGATATGCACCTTCACCACGATCTCGAGATCGTGGTGAAGGTGCATATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081823    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010895.2-1652s1c1
Sequence:CCGGCCAAGAGACTTCCTCCACATTCTCGAGAATGTGGAGGAAGTCTCTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010895.2-1138s1c1
Sequence:CCGGGCTCTGTCTCAACGGCAACTTCTCGAGAAGTTGCCGTTGAGACAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427839    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010895.3-1337s21c1
Sequence:CCGGTACGAGGAGCTCAACGCATTTCTCGAGAAATGCGTTGAGCTCCTCGTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427190    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010895.3-1863s21c1
Sequence:CCGGGCCTTCACCCTAACACGAATCCTCGAGGATTCGTGTTAGGGTGAAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413970    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010895.3-844s21c1
Sequence:CCGGGCAGCTAAACTCTCGTAACTTCTCGAGAAGTTACGAGAGTTTAGCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006160
VALIDATED
NEUROD2 MISSION shRNA Bacterial Glycerol Stock
neuronal differentiation 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000019909    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006160.2-1804s1c1
Sequence:CCGGCCCTCTTTCTTGAAGAGGGTACTCGAGTACCCTCTTCAAGAAAGAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019913    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006160.2-1164s1c1
Sequence:CCGGCTACCACTACTCTATGCACTACTCGAGTAGTGCATAGAGTAGTGGTAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019911    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006160.2-1104s1c1
Sequence:CCGGGCTCTGTCTCAATGGCAACTTCTCGAGAAGTTGCCATTGAGACAGAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006160.2-1266s1c1
Sequence:CCGGGAATCTCTTGTCTTACGATATCTCGAGATATCGTAAGACAAGAGATTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238797    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006160.3-825s21c1
Sequence:CCGGCAGCTCAACTCTCGCAACTTCCTCGAGGAAGTTGCGAGAGTTGAGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019912    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_006160.2-687s1c1
Sequence:CCGGGCGCCTAGCCAAGAACTATATCTCGAGATATAGTTCTTGGCTAGGCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234855    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006160.3-2342s21c1
Sequence:CCGGCAATCAGTGACTCGGAGATTTCTCGAGAAATCTCCGAGTCACTGATTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234854    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006160.3-1268s21c1
Sequence:CCGGGAATCTCTTGTCTTACGATATCTCGAGATATCGTAAGACAAGAGATTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234853    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006160.3-689s21c1
Sequence:CCGGGCGCCTAGCCAAGAACTATATCTCGAGATATAGTTCTTGGCTAGGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257234    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006160.3-1312s21c1
Sequence:CCGGCCATGTACGAGGAGCTCAATGCTCGAGCATTGAGCTCCTCGTACATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006160
VALIDATED
NEUROD2 MISSION shRNA shRNA Plasmid DNA
neuronal differentiation 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000019909    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006160.2-1804s1c1
Sequence:CCGGCCCTCTTTCTTGAAGAGGGTACTCGAGTACCCTCTTCAAGAAAGAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019913    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006160.2-1164s1c1
Sequence:CCGGCTACCACTACTCTATGCACTACTCGAGTAGTGCATAGAGTAGTGGTAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019911    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006160.2-1104s1c1
Sequence:CCGGGCTCTGTCTCAATGGCAACTTCTCGAGAAGTTGCCATTGAGACAGAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006160.2-1266s1c1
Sequence:CCGGGAATCTCTTGTCTTACGATATCTCGAGATATCGTAAGACAAGAGATTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238797    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006160.3-825s21c1
Sequence:CCGGCAGCTCAACTCTCGCAACTTCCTCGAGGAAGTTGCGAGAGTTGAGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019912    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_006160.2-687s1c1
Sequence:CCGGGCGCCTAGCCAAGAACTATATCTCGAGATATAGTTCTTGGCTAGGCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234855    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006160.3-2342s21c1
Sequence:CCGGCAATCAGTGACTCGGAGATTTCTCGAGAAATCTCCGAGTCACTGATTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234854    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006160.3-1268s21c1
Sequence:CCGGGAATCTCTTGTCTTACGATATCTCGAGATATCGTAAGACAAGAGATTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234853    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006160.3-689s21c1
Sequence:CCGGGCGCCTAGCCAAGAACTATATCTCGAGATATAGTTCTTGGCTAGGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257234    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006160.3-1312s21c1
Sequence:CCGGCCATGTACGAGGAGCTCAATGCTCGAGCATTGAGCTCCTCGTACATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006160
VALIDATED
NEUROD2 MISSION shRNA Lentiviral Transduction Particles
neuronal differentiation 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000019909    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006160.2-1804s1c1
Sequence:CCGGCCCTCTTTCTTGAAGAGGGTACTCGAGTACCCTCTTCAAGAAAGAGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019913    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006160.2-1164s1c1
Sequence:CCGGCTACCACTACTCTATGCACTACTCGAGTAGTGCATAGAGTAGTGGTAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019911    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006160.2-1104s1c1
Sequence:CCGGGCTCTGTCTCAATGGCAACTTCTCGAGAAGTTGCCATTGAGACAGAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006160.2-1266s1c1
Sequence:CCGGGAATCTCTTGTCTTACGATATCTCGAGATATCGTAAGACAAGAGATTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238797    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006160.3-825s21c1
Sequence:CCGGCAGCTCAACTCTCGCAACTTCCTCGAGGAAGTTGCGAGAGTTGAGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019912    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_006160.2-687s1c1
Sequence:CCGGGCGCCTAGCCAAGAACTATATCTCGAGATATAGTTCTTGGCTAGGCGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234855    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006160.3-2342s21c1
Sequence:CCGGCAATCAGTGACTCGGAGATTTCTCGAGAAATCTCCGAGTCACTGATTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234854    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006160.3-1268s21c1
Sequence:CCGGGAATCTCTTGTCTTACGATATCTCGAGATATCGTAAGACAAGAGATTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234853    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006160.3-689s21c1
Sequence:CCGGGCGCCTAGCCAAGAACTATATCTCGAGATATAGTTCTTGGCTAGGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257234    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006160.3-1312s21c1
Sequence:CCGGCCATGTACGAGGAGCTCAATGCTCGAGCATTGAGCTCCTCGTACATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)