EMAIL THIS PAGE TO A FRIEND

NEUROD4

neuronal differentiation 4

55 Gene Product Result for
Synonyms: ATH-3 ATH3 Atoh3 MATH-3 bHLHa4
UniProtKB ID: Q9HD90, B2RAC9
Gene ID:
Mouse(11923) neurogenic differentiation 4
Rat(288821) neuronal differentiation 4
Zebrafish(266958) neurogenic differentiation 4
chicken(395959) neuronal differentiation 4
cow(519656) neuronal differentiation 4
domestic cat(101095025) neuronal differentiation 4
naked mole-rat(101708343) neuronal differentiation 4
domestic guinea pig(100724964) neuronal differentiation 4
sheep(101120316) neuronal differentiation 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007501 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007501 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007501 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_021191 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021191 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021191 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU023191 MISSION® esiRNA esiRNA targeting mouse Neurod4 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021191 Rosetta Predictions human pricing
NM_001105942 Rosetta Predictions rat pricing
NM_007501 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021191 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00354767 predicted 1285
2 SASI_Hs02_00354768 predicted 1249
3 SASI_Hs01_00077378 predicted 773
4 SASI_Hs01_00077379 predicted 1003
5 SASI_Hs02_00354769 predicted 1332
6 SASI_Hs01_00077381 predicted 930
7 SASI_Hs02_00354770 predicted 958
8 SASI_Hs02_00354771 predicted 1356
9 SASI_Hs02_00354772 predicted 1374
10 SASI_Hs01_00077382 predicted 1092
11 SASI_Hs01_00077380 predicted 1041
12 SASI_Hs01_00077383 predicted 1056
13 SASI_Hs01_00077384 predicted 1113
14 SASI_Hs01_00077385 predicted 886
15 SASI_Hs01_00077386 predicted 1022
16 SASI_Hs01_00077387 predicted 1006
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105942 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00214062 predicted 1039
2 SASI_Rn02_00214063 predicted 759
3 SASI_Rn02_00214064 predicted 957
4 SASI_Rn02_00214065 predicted 504
5 SASI_Rn02_00214066 predicted 649
6 SASI_Rn02_00214067 predicted 987
7 SASI_Rn02_00214068 predicted 739
8 SASI_Rn02_00214069 predicted 501
9 SASI_Rn02_00214070 predicted 1156
10 SASI_Rn02_00214071 predicted 412
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007501 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00113316 predicted 671
2 SASI_Mm01_00113317 predicted 769
3 SASI_Mm02_00311778 predicted 621
4 SASI_Mm01_00113318 predicted 655
5 SASI_Mm01_00113319 predicted 1048
6 SASI_Mm01_00113320 predicted 1023
7 SASI_Mm01_00113321 predicted 968
8 SASI_Mm01_00113322 predicted 547
9 SASI_Mm01_00113323 predicted 998
10 SASI_Mm02_00311779 predicted 756
11 SASI_Mm01_00113315 predicted 1094
12 SASI_Mm01_00113324 predicted 520
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007501
NEUROD4 MISSION shRNA Bacterial Glycerol Stock
neuronal differentiation 4
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000431707    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007501.4-430s21c1
Sequence:CCGGGTCATGCCATGTTACTCTAAACTCGAGTTTAGAGTAACATGGCATGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417824    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007501.4-936s21c1
Sequence:CCGGTTATACCTCTGCAAGTCTAAGCTCGAGCTTAGACTTGCAGAGGTATAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424462    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007501.4-1265s21c1
Sequence:CCGGCATTGGACCAGTCCTACATTTCTCGAGAAATGTAGGACTGGTCCAATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429618    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007501.4-1381s21c1
Sequence:CCGGTTGAATGCTCTGCCAATTAACCTCGAGGTTAATTGGCAGAGCATTCAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075593    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007501.2-2182s1c1
Sequence:CCGGCCCACCTAACACTGATTGTTACTCGAGTAACAATCAGTGTTAGGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007501.2-447s1c1
Sequence:CCGGCTTTCCAAGATAGAGACTCTTCTCGAGAAGAGTCTCTATCTTGGAAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007501.2-755s1c1
Sequence:CCGGGCCTCAACCATTTAAGAGTTTCTCGAGAAACTCTTAAATGGTTGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007501.2-950s1c1
Sequence:CCGGGCATGTGCATTCAACTCCCTTCTCGAGAAGGGAGTTGAATGCACATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007501.2-196s1c1
Sequence:CCGGGCTCTTATGGAATGCTCGGAACTCGAGTTCCGAGCATTCCATAAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007501
NEUROD4 MISSION shRNA shRNA Plasmid DNA
neuronal differentiation 4
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000431707    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007501.4-430s21c1
Sequence:CCGGGTCATGCCATGTTACTCTAAACTCGAGTTTAGAGTAACATGGCATGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417824    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007501.4-936s21c1
Sequence:CCGGTTATACCTCTGCAAGTCTAAGCTCGAGCTTAGACTTGCAGAGGTATAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424462    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007501.4-1265s21c1
Sequence:CCGGCATTGGACCAGTCCTACATTTCTCGAGAAATGTAGGACTGGTCCAATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429618    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007501.4-1381s21c1
Sequence:CCGGTTGAATGCTCTGCCAATTAACCTCGAGGTTAATTGGCAGAGCATTCAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075593    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007501.2-2182s1c1
Sequence:CCGGCCCACCTAACACTGATTGTTACTCGAGTAACAATCAGTGTTAGGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007501.2-447s1c1
Sequence:CCGGCTTTCCAAGATAGAGACTCTTCTCGAGAAGAGTCTCTATCTTGGAAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007501.2-755s1c1
Sequence:CCGGGCCTCAACCATTTAAGAGTTTCTCGAGAAACTCTTAAATGGTTGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007501.2-950s1c1
Sequence:CCGGGCATGTGCATTCAACTCCCTTCTCGAGAAGGGAGTTGAATGCACATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007501.2-196s1c1
Sequence:CCGGGCTCTTATGGAATGCTCGGAACTCGAGTTCCGAGCATTCCATAAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007501
NEUROD4 MISSION shRNA Lentiviral Transduction Particles
neuronal differentiation 4
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000431707    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007501.4-430s21c1
Sequence:CCGGGTCATGCCATGTTACTCTAAACTCGAGTTTAGAGTAACATGGCATGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417824    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007501.4-936s21c1
Sequence:CCGGTTATACCTCTGCAAGTCTAAGCTCGAGCTTAGACTTGCAGAGGTATAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424462    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007501.4-1265s21c1
Sequence:CCGGCATTGGACCAGTCCTACATTTCTCGAGAAATGTAGGACTGGTCCAATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429618    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007501.4-1381s21c1
Sequence:CCGGTTGAATGCTCTGCCAATTAACCTCGAGGTTAATTGGCAGAGCATTCAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075593    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007501.2-2182s1c1
Sequence:CCGGCCCACCTAACACTGATTGTTACTCGAGTAACAATCAGTGTTAGGTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007501.2-447s1c1
Sequence:CCGGCTTTCCAAGATAGAGACTCTTCTCGAGAAGAGTCTCTATCTTGGAAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007501.2-755s1c1
Sequence:CCGGGCCTCAACCATTTAAGAGTTTCTCGAGAAACTCTTAAATGGTTGAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007501.2-950s1c1
Sequence:CCGGGCATGTGCATTCAACTCCCTTCTCGAGAAGGGAGTTGAATGCACATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007501.2-196s1c1
Sequence:CCGGGCTCTTATGGAATGCTCGGAACTCGAGTTCCGAGCATTCCATAAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021191
NEUROD4 MISSION shRNA Bacterial Glycerol Stock
neuronal differentiation 4
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000414859    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021191.2-1661s21c1
Sequence:CCGGGCATAATCTGTGCCAATTAATCTCGAGATTAATTGGCACAGATTATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418411    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021191.2-481s21c1
Sequence:CCGGGAGAGCAGACCAGGTACTTATCTCGAGATAAGTACCTGGTCTGCTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017628    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021191.1-744s1c1
Sequence:CCGGGCTCGAAGAGTCAAGGCTAATCTCGAGATTAGCCTTGACTCTTCGAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021191.1-1253s1c1
Sequence:CCGGCCTGAGCATCAGTGGGAACTTCTCGAGAAGTTCCCACTGATGCTCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021191.1-1321s1c1
Sequence:CCGGTCATGCCACATTACCCTTCTTCTCGAGAAGAAGGGTAATGTGGCATGATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021191.1-880s1c1
Sequence:CCGGCCAGGAACTATATTTGGGCTTCTCGAGAAGCCCAAATATAGTTCCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021191.1-1040s1c1
Sequence:CCGGGCACGAGGATAAATCTCCTATCTCGAGATAGGAGATTTATCCTCGTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021191
NEUROD4 MISSION shRNA shRNA Plasmid DNA
neuronal differentiation 4
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000414859    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021191.2-1661s21c1
Sequence:CCGGGCATAATCTGTGCCAATTAATCTCGAGATTAATTGGCACAGATTATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418411    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021191.2-481s21c1
Sequence:CCGGGAGAGCAGACCAGGTACTTATCTCGAGATAAGTACCTGGTCTGCTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017628    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021191.1-744s1c1
Sequence:CCGGGCTCGAAGAGTCAAGGCTAATCTCGAGATTAGCCTTGACTCTTCGAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021191.1-1253s1c1
Sequence:CCGGCCTGAGCATCAGTGGGAACTTCTCGAGAAGTTCCCACTGATGCTCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021191.1-1321s1c1
Sequence:CCGGTCATGCCACATTACCCTTCTTCTCGAGAAGAAGGGTAATGTGGCATGATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021191.1-880s1c1
Sequence:CCGGCCAGGAACTATATTTGGGCTTCTCGAGAAGCCCAAATATAGTTCCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021191.1-1040s1c1
Sequence:CCGGGCACGAGGATAAATCTCCTATCTCGAGATAGGAGATTTATCCTCGTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021191
NEUROD4 MISSION shRNA Lentiviral Transduction Particles
neuronal differentiation 4
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000414859    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021191.2-1661s21c1
Sequence:CCGGGCATAATCTGTGCCAATTAATCTCGAGATTAATTGGCACAGATTATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418411    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021191.2-481s21c1
Sequence:CCGGGAGAGCAGACCAGGTACTTATCTCGAGATAAGTACCTGGTCTGCTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017628    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021191.1-744s1c1
Sequence:CCGGGCTCGAAGAGTCAAGGCTAATCTCGAGATTAGCCTTGACTCTTCGAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021191.1-1253s1c1
Sequence:CCGGCCTGAGCATCAGTGGGAACTTCTCGAGAAGTTCCCACTGATGCTCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021191.1-1321s1c1
Sequence:CCGGTCATGCCACATTACCCTTCTTCTCGAGAAGAAGGGTAATGTGGCATGATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021191.1-880s1c1
Sequence:CCGGCCAGGAACTATATTTGGGCTTCTCGAGAAGCCCAAATATAGTTCCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021191.1-1040s1c1
Sequence:CCGGGCACGAGGATAAATCTCCTATCTCGAGATAGGAGATTTATCCTCGTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)