EMAIL THIS PAGE TO A FRIEND

NEUROD6

neuronal differentiation 6

112 Gene Product Result for
Synonyms: Atoh2 MATH2 Math-2 NEX1M Nex1 bHLHa2
UniProtKB ID: Q96NK8, Q548T9, Q9H3H6
Gene ID:
Human(63974) Summary: This gene is a member of the NEUROD family of basic helix-loop-helix transcription factors. The encoded protein may be involved in the development and differentiation of the nervous system. [provided by RefSeq, Nov 2012]
Mouse(11922) neurogenic differentiation 6
Rat(500137) neuronal differentiation 6
sheep(101122515) neuronal differentiation 6
domestic guinea pig(100717179) neuronal differentiation 6
naked mole-rat(101715972) neuronal differentiation 6
chicken(420754) neuronal differentiation 6
domestic cat(101089001) neuronal differentiation 6
cow(540464) neurogenic differentiation 6
Horse(100055160) neuronal differentiation 6
dog(482387) neuronal differentiation 6
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009717 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009717 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009717 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_022728 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022728 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022728 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU007041 MISSION® esiRNA esiRNA targeting human NEUROD6 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022728 Rosetta Predictions human pricing
NM_001109237 Rosetta Predictions rat pricing
NM_009717 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022728 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00128638 predicted 1069
2 SASI_Hs01_00128639 predicted 1053
3 SASI_Hs01_00128640 predicted 1114
4 SASI_Hs01_00128641 predicted 809
5 SASI_Hs01_00128642 predicted 905
6 SASI_Hs01_00128643 predicted 1317
7 SASI_Hs01_00128644 predicted 1037
8 SASI_Hs01_00128645 predicted 1066
9 SASI_Hs01_00128646 predicted 941
10 SASI_Hs01_00128647 predicted 845
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109237 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00246434 predicted 1122
2 SASI_Rn02_00246435 predicted 833
3 SASI_Rn02_00246436 predicted 917
4 SASI_Rn02_00246437 predicted 1084
5 SASI_Rn02_00246438 predicted 653
6 SASI_Rn02_00246439 predicted 838
7 SASI_Rn02_00246440 predicted 977
8 SASI_Rn02_00246441 predicted 1117
9 SASI_Rn02_00246442 predicted 626
10 SASI_Rn02_00246443 predicted 868
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009717 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00067933 predicted 1291
2 SASI_Mm01_00067934 predicted 996
3 SASI_Mm01_00067937 predicted 1147
4 SASI_Mm01_00067938 predicted 1283
5 SASI_Mm01_00067939 predicted 1111
6 SASI_Mm01_00067940 predicted 821
7 SASI_Mm01_00067941 predicted 783
8 SASI_Mm01_00067942 predicted 1003
9 SASI_Mm02_00316871 predicted 1255
10 SASI_Mm02_00316872 predicted 1036
11 SASI_Mm01_00067935 predicted 891
12 SASI_Mm01_00067936 predicted 815
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009717
NEUROD6 MISSION shRNA Bacterial Glycerol Stock
neuronal differentiation 6
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000082283    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009717.1-1226s1c1
Sequence:CCGGCAACTCTATCTAAGGTGTTTACTCGAGTAAACACCTTAGATAGAGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009717.1-887s1c1
Sequence:CCGGCCTCAGTTTGAAGGTCCCTTACTCGAGTAAGGGACCTTCAAACTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009717.1-378s1c1
Sequence:CCGGCCACCAAACTACGACTGGAAACTCGAGTTTCCAGTCGTAGTTTGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009717.1-1064s1c1
Sequence:CCGGCACTTCCCTTACGACTTACATCTCGAGATGTAAGTCGTAAGGGAAGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009717.1-180s1c1
Sequence:CCGGGCAGAAAGTTTGCTAGACAATCTCGAGATTGTCTAGCAAACTTTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436532    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009717.2-650s21c1
Sequence:CCGGTCAATGATGCTCTGGACAATTCTCGAGAATTGTCCAGAGCATCATTGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420681    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009717.2-1691s21c1
Sequence:CCGGAGCATACTTCAATGTCTATTTCTCGAGAAATAGACATTGAAGTATGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009717
NEUROD6 MISSION shRNA shRNA Plasmid DNA
neuronal differentiation 6
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000082283    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009717.1-1226s1c1
Sequence:CCGGCAACTCTATCTAAGGTGTTTACTCGAGTAAACACCTTAGATAGAGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009717.1-887s1c1
Sequence:CCGGCCTCAGTTTGAAGGTCCCTTACTCGAGTAAGGGACCTTCAAACTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009717.1-378s1c1
Sequence:CCGGCCACCAAACTACGACTGGAAACTCGAGTTTCCAGTCGTAGTTTGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009717.1-1064s1c1
Sequence:CCGGCACTTCCCTTACGACTTACATCTCGAGATGTAAGTCGTAAGGGAAGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009717.1-180s1c1
Sequence:CCGGGCAGAAAGTTTGCTAGACAATCTCGAGATTGTCTAGCAAACTTTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436532    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009717.2-650s21c1
Sequence:CCGGTCAATGATGCTCTGGACAATTCTCGAGAATTGTCCAGAGCATCATTGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420681    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009717.2-1691s21c1
Sequence:CCGGAGCATACTTCAATGTCTATTTCTCGAGAAATAGACATTGAAGTATGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009717
NEUROD6 MISSION shRNA Lentiviral Transduction Particles
neuronal differentiation 6
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000082283    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009717.1-1226s1c1
Sequence:CCGGCAACTCTATCTAAGGTGTTTACTCGAGTAAACACCTTAGATAGAGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009717.1-887s1c1
Sequence:CCGGCCTCAGTTTGAAGGTCCCTTACTCGAGTAAGGGACCTTCAAACTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009717.1-378s1c1
Sequence:CCGGCCACCAAACTACGACTGGAAACTCGAGTTTCCAGTCGTAGTTTGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009717.1-1064s1c1
Sequence:CCGGCACTTCCCTTACGACTTACATCTCGAGATGTAAGTCGTAAGGGAAGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009717.1-180s1c1
Sequence:CCGGGCAGAAAGTTTGCTAGACAATCTCGAGATTGTCTAGCAAACTTTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436532    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009717.2-650s21c1
Sequence:CCGGTCAATGATGCTCTGGACAATTCTCGAGAATTGTCCAGAGCATCATTGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420681    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009717.2-1691s21c1
Sequence:CCGGAGCATACTTCAATGTCTATTTCTCGAGAAATAGACATTGAAGTATGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022728
NEUROD6 MISSION shRNA Bacterial Glycerol Stock
neuronal differentiation 6
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000020850    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022728.2-1069s1c1
Sequence:CCGGCGTATGAATCCTTCTATGAAACTCGAGTTTCATAGAAGGATTCATACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020849    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022728.2-1175s1c1
Sequence:CCGGGCAAGAAGAAACCTTGGACTACTCGAGTAGTCCAAGGTTTCTTCTTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022728.2-479s1c1
Sequence:CCGGCCTTCGAGGAAAGAGCATCAACTCGAGTTGATGCTCTTTCCTCGAAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022728.2-1142s1c1
Sequence:CCGGCCCAATTAACTATAATGGGATCTCGAGATCCCATTATAGTTAATTGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020853    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022728.2-1326s1c1
Sequence:CCGGCTCACAATGCAAGATGAATTACTCGAGTAATTCATCTTGCATTGTGAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434754    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022728.2-1838s21c1
Sequence:CCGGCACTAAGCTGACAATGATATTCTCGAGAATATCATTGTCAGCTTAGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432312    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022728.2-1453s21c1
Sequence:CCGGCAACTCTATCTAAGGTGTTTACTCGAGTAAACACCTTAGATAGAGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022728
NEUROD6 MISSION shRNA shRNA Plasmid DNA
neuronal differentiation 6
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000020850    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022728.2-1069s1c1
Sequence:CCGGCGTATGAATCCTTCTATGAAACTCGAGTTTCATAGAAGGATTCATACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020849    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022728.2-1175s1c1
Sequence:CCGGGCAAGAAGAAACCTTGGACTACTCGAGTAGTCCAAGGTTTCTTCTTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022728.2-479s1c1
Sequence:CCGGCCTTCGAGGAAAGAGCATCAACTCGAGTTGATGCTCTTTCCTCGAAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022728.2-1142s1c1
Sequence:CCGGCCCAATTAACTATAATGGGATCTCGAGATCCCATTATAGTTAATTGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020853    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022728.2-1326s1c1
Sequence:CCGGCTCACAATGCAAGATGAATTACTCGAGTAATTCATCTTGCATTGTGAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434754    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022728.2-1838s21c1
Sequence:CCGGCACTAAGCTGACAATGATATTCTCGAGAATATCATTGTCAGCTTAGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432312    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022728.2-1453s21c1
Sequence:CCGGCAACTCTATCTAAGGTGTTTACTCGAGTAAACACCTTAGATAGAGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022728
NEUROD6 MISSION shRNA Lentiviral Transduction Particles
neuronal differentiation 6
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000020850    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022728.2-1069s1c1
Sequence:CCGGCGTATGAATCCTTCTATGAAACTCGAGTTTCATAGAAGGATTCATACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020849    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022728.2-1175s1c1
Sequence:CCGGGCAAGAAGAAACCTTGGACTACTCGAGTAGTCCAAGGTTTCTTCTTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022728.2-479s1c1
Sequence:CCGGCCTTCGAGGAAAGAGCATCAACTCGAGTTGATGCTCTTTCCTCGAAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022728.2-1142s1c1
Sequence:CCGGCCCAATTAACTATAATGGGATCTCGAGATCCCATTATAGTTAATTGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020853    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022728.2-1326s1c1
Sequence:CCGGCTCACAATGCAAGATGAATTACTCGAGTAATTCATCTTGCATTGTGAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434754    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022728.2-1838s21c1
Sequence:CCGGCACTAAGCTGACAATGATATTCTCGAGAATATCATTGTCAGCTTAGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432312    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022728.2-1453s21c1
Sequence:CCGGCAACTCTATCTAAGGTGTTTACTCGAGTAAACACCTTAGATAGAGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)