EMAIL THIS PAGE TO A FRIEND

NEUROG1

neurogenin 1

100 Gene Product Result for
Synonyms: AKA Math4C NEUROD3 bHLHa6 ngn1
UniProtKB ID: Q92886, Q5U0Q9, Q96HE1
Gene ID:
Mouse(18014) neurogenin 1
Rat(29410) neurogenin 1
Zebrafish(30239) neurogenin 1
dog(481516) neurogenin 1
cow(508548) neurogenin 1
chicken(395699) neurogenin 1
sheep(101104992) neurogenin 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010896 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010896 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010896 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006161 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006161 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006161 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006161 Rosetta Predictions human pricing
NM_019207 Rosetta Predictions rat pricing
NM_010896 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006161 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00067534 predicted 1270
2 SASI_Hs02_00341011 predicted 1429
3 SASI_Hs01_00067536 predicted 1208
4 SASI_Hs01_00067537 predicted 1062
5 SASI_Hs01_00067538 predicted 941
6 SASI_Hs01_00067539 predicted 1226
7 SASI_Hs01_00067540 predicted 976
8 SASI_Hs01_00067541 predicted 1332
9 SASI_Hs01_00067542 predicted 1378
10 SASI_Hs02_00341012 predicted 1265
11 SASI_Hs01_00067535 predicted 1425
12 SASI_Hs01_00067543 predicted 952
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019207 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00118614 predicted 975
2 SASI_Rn01_00118615 predicted 981
3 SASI_Rn01_00118616 predicted 835
4 SASI_Rn01_00118617 predicted 982
5 SASI_Rn01_00118618 predicted 623
6 SASI_Rn01_00118619 predicted 985
7 SASI_Rn01_00118620 predicted 549
8 SASI_Rn01_00118621 predicted 951
9 SASI_Rn02_00262040 predicted 829
10 SASI_Rn01_00118623 predicted 987
11 SASI_Rn01_00118622 predicted 972
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010896 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00161700 predicted 1443
2 SASI_Mm01_00161701 predicted 930
3 SASI_Mm02_00319612 predicted 934
4 SASI_Mm01_00161702 predicted 607
5 SASI_Mm01_00161703 predicted 942
6 SASI_Mm01_00161704 predicted 1404
7 SASI_Mm01_00161705 predicted 1429
8 SASI_Mm01_00161706 predicted 668
9 SASI_Mm01_00161707 predicted 1397
10 SASI_Mm01_00161708 predicted 854
11 SASI_Mm01_00161709 predicted 853
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010896
NEUROG1 MISSION shRNA Bacterial Glycerol Stock
neurogenin 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000432544    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010896.2-1100s21c1
Sequence:CCGGGAATACCTGACCACTTGTTAGCTCGAGCTAACAAGTGGTCAGGTATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426002    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010896.2-907s21c1
Sequence:CCGGTTTCCTGGCCTGCCCAAAGACCTCGAGGTCTTTGGGCAGGCCAGGAAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423123    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010896.2-1137s21c1
Sequence:CCGGTGAAGCTGCCCTCGGTCTATTCTCGAGAATAGACCGAGGGCAGCTTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427619    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010896.2-940s21c1
Sequence:CCGGACGCCCTGTTTCATCCCATACCTCGAGGTATGGGATGAAACAGGGCGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081858    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010896.1-280s1c1
Sequence:CCGGCGTCGCGTCAAAGCCAACGATCTCGAGATCGTTGGCTTTGACGCGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010896.1-33s1c1
Sequence:CCGGTCTCGACTGCTCCAGCAGCAACTCGAGTTGCTGCTGGAGCAGTCGAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081859    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010896.1-378s1c1
Sequence:CCGGCACCAAGCTCACCAAGATTGACTCGAGTCAATCTTGGTGAGCTTGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010896.1-539s1c1
Sequence:CCGGCGGCCAGCGACACTGAGTCCTCTCGAGAGGACTCAGTGTCGCTGGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010896
NEUROG1 MISSION shRNA shRNA Plasmid DNA
neurogenin 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000432544    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010896.2-1100s21c1
Sequence:CCGGGAATACCTGACCACTTGTTAGCTCGAGCTAACAAGTGGTCAGGTATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426002    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010896.2-907s21c1
Sequence:CCGGTTTCCTGGCCTGCCCAAAGACCTCGAGGTCTTTGGGCAGGCCAGGAAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423123    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010896.2-1137s21c1
Sequence:CCGGTGAAGCTGCCCTCGGTCTATTCTCGAGAATAGACCGAGGGCAGCTTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427619    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010896.2-940s21c1
Sequence:CCGGACGCCCTGTTTCATCCCATACCTCGAGGTATGGGATGAAACAGGGCGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081858    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010896.1-280s1c1
Sequence:CCGGCGTCGCGTCAAAGCCAACGATCTCGAGATCGTTGGCTTTGACGCGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010896.1-33s1c1
Sequence:CCGGTCTCGACTGCTCCAGCAGCAACTCGAGTTGCTGCTGGAGCAGTCGAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081859    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010896.1-378s1c1
Sequence:CCGGCACCAAGCTCACCAAGATTGACTCGAGTCAATCTTGGTGAGCTTGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010896.1-539s1c1
Sequence:CCGGCGGCCAGCGACACTGAGTCCTCTCGAGAGGACTCAGTGTCGCTGGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010896
NEUROG1 MISSION shRNA Lentiviral Transduction Particles
neurogenin 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000432544    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010896.2-1100s21c1
Sequence:CCGGGAATACCTGACCACTTGTTAGCTCGAGCTAACAAGTGGTCAGGTATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426002    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010896.2-907s21c1
Sequence:CCGGTTTCCTGGCCTGCCCAAAGACCTCGAGGTCTTTGGGCAGGCCAGGAAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423123    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010896.2-1137s21c1
Sequence:CCGGTGAAGCTGCCCTCGGTCTATTCTCGAGAATAGACCGAGGGCAGCTTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427619    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010896.2-940s21c1
Sequence:CCGGACGCCCTGTTTCATCCCATACCTCGAGGTATGGGATGAAACAGGGCGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081858    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010896.1-280s1c1
Sequence:CCGGCGTCGCGTCAAAGCCAACGATCTCGAGATCGTTGGCTTTGACGCGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010896.1-33s1c1
Sequence:CCGGTCTCGACTGCTCCAGCAGCAACTCGAGTTGCTGCTGGAGCAGTCGAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081859    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010896.1-378s1c1
Sequence:CCGGCACCAAGCTCACCAAGATTGACTCGAGTCAATCTTGGTGAGCTTGGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010896.1-539s1c1
Sequence:CCGGCGGCCAGCGACACTGAGTCCTCTCGAGAGGACTCAGTGTCGCTGGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006161
NEUROG1 MISSION shRNA Bacterial Glycerol Stock
neurogenin 1
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000428806    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006161.2-1099s21c1
Sequence:CCGGGATACCTGAGCCGCTTGTTAGCTCGAGCTAACAAGCGGCTCAGGTATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017313    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006161.2-1389s1c1
Sequence:CCGGCCGGCTGACAATACAATGAAACTCGAGTTTCATTGTATTGTCAGCCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006161.2-316s1c1
Sequence:CCGGCAGTGACCTATCCGGCTTCCTCTCGAGAGGAAGCCGGATAGGTCACTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006161.2-339s1c1
Sequence:CCGGCCGACGAGGAAGACTGTGCCACTCGAGTGGCACAGTCTTCCTCGTCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006161.2-949s1c1
Sequence:CCGGGCCCTGTTTCATTCCTTACCACTCGAGTGGTAAGGAATGAAACAGGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017315    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006161.2-937s1c1
Sequence:CCGGGCTCCACACAACGCCCTGTTTCTCGAGAAACAGGGCGTTGTGTGGAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006161
NEUROG1 MISSION shRNA shRNA Plasmid DNA
neurogenin 1
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000428806    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006161.2-1099s21c1
Sequence:CCGGGATACCTGAGCCGCTTGTTAGCTCGAGCTAACAAGCGGCTCAGGTATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017313    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006161.2-1389s1c1
Sequence:CCGGCCGGCTGACAATACAATGAAACTCGAGTTTCATTGTATTGTCAGCCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006161.2-316s1c1
Sequence:CCGGCAGTGACCTATCCGGCTTCCTCTCGAGAGGAAGCCGGATAGGTCACTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006161.2-339s1c1
Sequence:CCGGCCGACGAGGAAGACTGTGCCACTCGAGTGGCACAGTCTTCCTCGTCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006161.2-949s1c1
Sequence:CCGGGCCCTGTTTCATTCCTTACCACTCGAGTGGTAAGGAATGAAACAGGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017315    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006161.2-937s1c1
Sequence:CCGGGCTCCACACAACGCCCTGTTTCTCGAGAAACAGGGCGTTGTGTGGAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006161
NEUROG1 MISSION shRNA Lentiviral Transduction Particles
neurogenin 1
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000428806    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006161.2-1099s21c1
Sequence:CCGGGATACCTGAGCCGCTTGTTAGCTCGAGCTAACAAGCGGCTCAGGTATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017313    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006161.2-1389s1c1
Sequence:CCGGCCGGCTGACAATACAATGAAACTCGAGTTTCATTGTATTGTCAGCCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006161.2-316s1c1
Sequence:CCGGCAGTGACCTATCCGGCTTCCTCTCGAGAGGAAGCCGGATAGGTCACTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006161.2-339s1c1
Sequence:CCGGCCGACGAGGAAGACTGTGCCACTCGAGTGGCACAGTCTTCCTCGTCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006161.2-949s1c1
Sequence:CCGGGCCCTGTTTCATTCCTTACCACTCGAGTGGTAAGGAATGAAACAGGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017315    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006161.2-937s1c1
Sequence:CCGGGCTCCACACAACGCCCTGTTTCTCGAGAAACAGGGCGTTGTGTGGAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)