EMAIL THIS PAGE TO A FRIEND

NEUROG3

neurogenin 3

55 Gene Product Result for
Synonyms: Atoh5 Math4B NGN-3 bHLHa7 ngn3
UniProtKB ID: Q9Y4Z2, Q5VVI0, Q6DJX6, Q9BY24
Gene ID:
Human(50674) Summary: The protein encoded by this gene is a basic helix-loop-helix (bHLH) transcription factor involved in neurogenesis. The encoded protein likely acts as a heterodimer with another bHLH protein. Defects in this gene are a cause of congenital malabsorptive diarrhea 4 (DIAR4).[provided by RefSeq, May 2010]
Mouse(11925) neurogenin 3
Rat(60329) neurogenin 3
Zebrafish(114411) neurogenin 3
cow(540130) neurogenin 3
dog(489022) neurogenin 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009719 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009719 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009719 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_020999 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020999 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020999 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU010391 MISSION® esiRNA esiRNA targeting mouse Neurog3 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020999 Rosetta Predictions human pricing
NM_021700 Rosetta Predictions rat pricing
NM_009719 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020999 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00192264 predicted 899
2 SASI_Hs01_00192265 predicted 367
3 SASI_Hs01_00192266 predicted 367
4 SASI_Hs01_00192267 predicted 281
5 SASI_Hs01_00192268 predicted 435
6 SASI_Hs01_00192269 predicted 830
7 SASI_Hs01_00192270 predicted 567
8 SASI_Hs01_00192271 predicted 571
9 SASI_Hs01_00192272 predicted 195
10 SASI_Hs01_00192273 predicted 489
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021700 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00096296 predicted 1145
2 SASI_Rn01_00096298 predicted 655
3 SASI_Rn01_00096299 predicted 534
4 SASI_Rn01_00096300 predicted 1152
5 SASI_Rn01_00096302 predicted 532
6 SASI_Rn01_00096303 predicted 693
7 SASI_Rn01_00096304 predicted 670
8 SASI_Rn02_00262745 predicted 1242
9 SASI_Rn01_00096305 predicted 1220
10 SASI_Rn02_00262746 predicted 486
11 SASI_Rn01_00096297 predicted 798
12 SASI_Rn01_00096301 predicted 546
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009719 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00077395 predicted 1014
2 SASI_Mm01_00077397 predicted 850
3 SASI_Mm01_00077399 predicted 1291
4 SASI_Mm01_00077400 predicted 440
5 SASI_Mm02_00316874 predicted 1152
6 SASI_Mm02_00316875 predicted 451
7 SASI_Mm01_00077401 predicted 494
8 SASI_Mm01_00077402 predicted 1159
9 SASI_Mm01_00077403 predicted 969
10 SASI_Mm01_00077404 predicted 1121
11 SASI_Mm01_00077396 predicted 1161
12 SASI_Mm01_00077398 predicted 464
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009719
NEUROG3 MISSION shRNA Bacterial Glycerol Stock
neurogenin 3
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436432    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009719.6-582s21c1
Sequence:CCGGGATGACGCCAAACTTACAAAGCTCGAGCTTTGTAAGTTTGGCGTCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427997    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009719.6-1300s21c1
Sequence:CCGGGATGATGTTCGTCGTCTTTACCTCGAGGTAAAGACGACGAACATCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417237    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009719.6-1245s21c1
Sequence:CCGGTAATCCAGTGTTGCGTCTTACCTCGAGGTAAGACGCAACACTGGATTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419775    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009719.6-975s21c1
Sequence:CCGGATCTCGCCTCTTCTGGCTTTCCTCGAGGAAAGCCAGAAGAGGCGAGATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009719.4-502s1c1
Sequence:CCGGGCCAATGATCGGGAGCGCAATCTCGAGATTGCGCTCCCGATCATTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084233    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009719.4-1134s1c1
Sequence:CCGGCATTTGAGAATGGTAGCACTACTCGAGTAGTGCTACCATTCTCAAATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009719.4-490s1c1
Sequence:CCGGCGGCGCAAGAAGGCCAATGATCTCGAGATCATTGGCCTTCTTGCGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009719.4-314s1c1
Sequence:CCGGCGGACCACGAAGTGCTCAGTTCTCGAGAACTGAGCACTTCGTGGTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084235    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009719.4-590s1c1
Sequence:CCGGCCAAACTTACAAAGGTCGAGACTCGAGTCTCGACCTTTGTAAGTTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009719
NEUROG3 MISSION shRNA shRNA Plasmid DNA
neurogenin 3
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436432    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009719.6-582s21c1
Sequence:CCGGGATGACGCCAAACTTACAAAGCTCGAGCTTTGTAAGTTTGGCGTCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427997    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009719.6-1300s21c1
Sequence:CCGGGATGATGTTCGTCGTCTTTACCTCGAGGTAAAGACGACGAACATCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417237    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009719.6-1245s21c1
Sequence:CCGGTAATCCAGTGTTGCGTCTTACCTCGAGGTAAGACGCAACACTGGATTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419775    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009719.6-975s21c1
Sequence:CCGGATCTCGCCTCTTCTGGCTTTCCTCGAGGAAAGCCAGAAGAGGCGAGATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009719.4-502s1c1
Sequence:CCGGGCCAATGATCGGGAGCGCAATCTCGAGATTGCGCTCCCGATCATTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084233    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009719.4-1134s1c1
Sequence:CCGGCATTTGAGAATGGTAGCACTACTCGAGTAGTGCTACCATTCTCAAATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009719.4-490s1c1
Sequence:CCGGCGGCGCAAGAAGGCCAATGATCTCGAGATCATTGGCCTTCTTGCGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009719.4-314s1c1
Sequence:CCGGCGGACCACGAAGTGCTCAGTTCTCGAGAACTGAGCACTTCGTGGTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084235    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009719.4-590s1c1
Sequence:CCGGCCAAACTTACAAAGGTCGAGACTCGAGTCTCGACCTTTGTAAGTTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009719
NEUROG3 MISSION shRNA Lentiviral Transduction Particles
neurogenin 3
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436432    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009719.6-582s21c1
Sequence:CCGGGATGACGCCAAACTTACAAAGCTCGAGCTTTGTAAGTTTGGCGTCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427997    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009719.6-1300s21c1
Sequence:CCGGGATGATGTTCGTCGTCTTTACCTCGAGGTAAAGACGACGAACATCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417237    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009719.6-1245s21c1
Sequence:CCGGTAATCCAGTGTTGCGTCTTACCTCGAGGTAAGACGCAACACTGGATTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419775    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009719.6-975s21c1
Sequence:CCGGATCTCGCCTCTTCTGGCTTTCCTCGAGGAAAGCCAGAAGAGGCGAGATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009719.4-502s1c1
Sequence:CCGGGCCAATGATCGGGAGCGCAATCTCGAGATTGCGCTCCCGATCATTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084233    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009719.4-1134s1c1
Sequence:CCGGCATTTGAGAATGGTAGCACTACTCGAGTAGTGCTACCATTCTCAAATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009719.4-490s1c1
Sequence:CCGGCGGCGCAAGAAGGCCAATGATCTCGAGATCATTGGCCTTCTTGCGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009719.4-314s1c1
Sequence:CCGGCGGACCACGAAGTGCTCAGTTCTCGAGAACTGAGCACTTCGTGGTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084235    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009719.4-590s1c1
Sequence:CCGGCCAAACTTACAAAGGTCGAGACTCGAGTCTCGACCTTTGTAAGTTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020999
NEUROG3 MISSION shRNA Bacterial Glycerol Stock
neurogenin 3
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000427521    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020999.2-798s21c1
Sequence:CCGGCTGTGAAAGGACCTGTCTGTCCTCGAGGACAGACAGGTCCTTTCACAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426910    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020999.2-900s21c1
Sequence:CCGGAGCACTTGTTCCTTCTGCTTCCTCGAGGAAGCAGAAGGAACAAGTGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020999.1-776s1c1
Sequence:CCGGCAGTCTGGCTTTCTCAGATTTCTCGAGAAATCTGAGAAAGCCAGACTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020999.1-229s1c1
Sequence:CCGGCCTCGGAAGACGAAGTGACCTCTCGAGAGGTCACTTCGTCTTCCGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020999.1-374s1c1
Sequence:CCGGGAGCGAGTTGGCACTGAGCAACTCGAGTTGCTCAGTGCCAACTCGCTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020999.1-398s1c1
Sequence:CCGGGCGACGGAGTCGGCGAAAGAACTCGAGTTCTTTCGCCGACTCCGTCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020035    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020999.1-560s1c1
Sequence:CCGGGCTGACTCAAACGCTGCGCATCTCGAGATGCGCAGCGTTTGAGTCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020999
NEUROG3 MISSION shRNA shRNA Plasmid DNA
neurogenin 3
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000427521    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020999.2-798s21c1
Sequence:CCGGCTGTGAAAGGACCTGTCTGTCCTCGAGGACAGACAGGTCCTTTCACAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426910    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020999.2-900s21c1
Sequence:CCGGAGCACTTGTTCCTTCTGCTTCCTCGAGGAAGCAGAAGGAACAAGTGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020999.1-776s1c1
Sequence:CCGGCAGTCTGGCTTTCTCAGATTTCTCGAGAAATCTGAGAAAGCCAGACTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020999.1-229s1c1
Sequence:CCGGCCTCGGAAGACGAAGTGACCTCTCGAGAGGTCACTTCGTCTTCCGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020999.1-374s1c1
Sequence:CCGGGAGCGAGTTGGCACTGAGCAACTCGAGTTGCTCAGTGCCAACTCGCTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020999.1-398s1c1
Sequence:CCGGGCGACGGAGTCGGCGAAAGAACTCGAGTTCTTTCGCCGACTCCGTCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020035    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020999.1-560s1c1
Sequence:CCGGGCTGACTCAAACGCTGCGCATCTCGAGATGCGCAGCGTTTGAGTCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020999
NEUROG3 MISSION shRNA Lentiviral Transduction Particles
neurogenin 3
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000427521    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020999.2-798s21c1
Sequence:CCGGCTGTGAAAGGACCTGTCTGTCCTCGAGGACAGACAGGTCCTTTCACAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426910    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020999.2-900s21c1
Sequence:CCGGAGCACTTGTTCCTTCTGCTTCCTCGAGGAAGCAGAAGGAACAAGTGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020999.1-776s1c1
Sequence:CCGGCAGTCTGGCTTTCTCAGATTTCTCGAGAAATCTGAGAAAGCCAGACTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020999.1-229s1c1
Sequence:CCGGCCTCGGAAGACGAAGTGACCTCTCGAGAGGTCACTTCGTCTTCCGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020999.1-374s1c1
Sequence:CCGGGAGCGAGTTGGCACTGAGCAACTCGAGTTGCTCAGTGCCAACTCGCTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020999.1-398s1c1
Sequence:CCGGGCGACGGAGTCGGCGAAAGAACTCGAGTTCTTTCGCCGACTCCGTCGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020035    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020999.1-560s1c1
Sequence:CCGGGCTGACTCAAACGCTGCGCATCTCGAGATGCGCAGCGTTTGAGTCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)