EMAIL THIS PAGE TO A FRIEND

NEXN-AS1

NEXN antisense RNA 1

40 Gene Product Result for
Synonyms: C1orf118
Species: Human NEXN-AS1(374987)
UniProtKB ID: Q8NBZ9
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_199343 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_199343 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_199343 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001039463 Rosetta Predictions human pricing
XR_041257 Rosetta Predictions human pricing
XR_041258 Rosetta Predictions human pricing
XR_041259 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039463 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00246470 predicted 312
2 SASI_Hs01_00246471 predicted 299
3 SASI_Hs01_00246472 predicted 1062
4 SASI_Hs01_00246473 predicted 283
5 SASI_Hs01_00246474 predicted 1061
6 SASI_Hs01_00246475 predicted 237
7 SASI_Hs01_00246476 predicted 963
8 SASI_Hs01_00246477 predicted 405
9 SASI_Hs01_00246478 predicted 230
10 SASI_Hs01_00246479 predicted 1045
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041257 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00525890 predicted 297
2 SASI_Hs02_00525891 predicted 1053
3 SASI_Hs02_00525892 predicted 290
4 SASI_Hs02_00525893 predicted 221
5 SASI_Hs02_00525894 predicted 1028
6 SASI_Hs02_00525895 predicted 947
7 SASI_Hs02_00525896 predicted 287
8 SASI_Hs02_00525897 predicted 221
9 SASI_Hs02_00525898 predicted 226
10 SASI_Hs02_00525899 predicted 1089
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041258 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00525900 predicted 249
2 SASI_Hs02_00525901 predicted 216
3 SASI_Hs02_00525902 predicted 209
4 SASI_Hs02_00525903 predicted 201
5 SASI_Hs02_00525904 predicted 254
6 SASI_Hs02_00525905 predicted 206
7 SASI_Hs02_00525906 predicted 210
8 SASI_Hs02_00525907 predicted 246
9 SASI_Hs02_00525908 predicted 893
10 SASI_Hs02_00525909 predicted 1036
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_041259 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00525910 predicted 1050
2 SASI_Hs02_00525911 predicted 294
3 SASI_Hs02_00525912 predicted 225
4 SASI_Hs02_00525913 predicted 1030
5 SASI_Hs02_00525914 predicted 950
6 SASI_Hs02_00525915 predicted 270
7 SASI_Hs02_00525916 predicted 290
8 SASI_Hs02_00525917 predicted 229
9 SASI_Hs02_00525918 predicted 234
10 SASI_Hs02_00525919 predicted 1094
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_199343
NEXN-AS1 MISSION shRNA Bacterial Glycerol Stock
NEXN antisense RNA 1
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000181193    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_199343.1-1261s1c1
Sequence:CCGGCGGGAACACTTCATCTGTCTACTCGAGTAGACAGATGAAGTGTTCCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181150    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199343.1-746s1c1
Sequence:CCGGCTCCAGCAGCAAGTTTCCATACTCGAGTATGGAAACTTGCTGCTGGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180436    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199343.1-72s1c1
Sequence:CCGGGAGAGACCGATCAGAAAGGATCTCGAGATCCTTTCTGATCGGTCTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179697    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199343.1-281s1c1
Sequence:CCGGGCAAAGACATTGCAACCAGAACTCGAGTTCTGGTTGCAATGTCTTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180775    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199343.1-62s1c1
Sequence:CCGGGAGTTCTCAAGAGAGACCGATCTCGAGATCGGTCTCTCTTGAGAACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180989    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199343.1-67s1c1
Sequence:CCGGCTCAAGAGAGACCGATCAGAACTCGAGTTCTGATCGGTCTCTCTTGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_199343
NEXN-AS1 MISSION shRNA shRNA Plasmid DNA
NEXN antisense RNA 1
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000181193    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_199343.1-1261s1c1
Sequence:CCGGCGGGAACACTTCATCTGTCTACTCGAGTAGACAGATGAAGTGTTCCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181150    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199343.1-746s1c1
Sequence:CCGGCTCCAGCAGCAAGTTTCCATACTCGAGTATGGAAACTTGCTGCTGGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180436    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199343.1-72s1c1
Sequence:CCGGGAGAGACCGATCAGAAAGGATCTCGAGATCCTTTCTGATCGGTCTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179697    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199343.1-281s1c1
Sequence:CCGGGCAAAGACATTGCAACCAGAACTCGAGTTCTGGTTGCAATGTCTTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180775    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199343.1-62s1c1
Sequence:CCGGGAGTTCTCAAGAGAGACCGATCTCGAGATCGGTCTCTCTTGAGAACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180989    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199343.1-67s1c1
Sequence:CCGGCTCAAGAGAGACCGATCAGAACTCGAGTTCTGATCGGTCTCTCTTGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_199343
NEXN-AS1 MISSION shRNA Lentiviral Transduction Particles
NEXN antisense RNA 1
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000181193    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_199343.1-1261s1c1
Sequence:CCGGCGGGAACACTTCATCTGTCTACTCGAGTAGACAGATGAAGTGTTCCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181150    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199343.1-746s1c1
Sequence:CCGGCTCCAGCAGCAAGTTTCCATACTCGAGTATGGAAACTTGCTGCTGGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180436    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199343.1-72s1c1
Sequence:CCGGGAGAGACCGATCAGAAAGGATCTCGAGATCCTTTCTGATCGGTCTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179697    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199343.1-281s1c1
Sequence:CCGGGCAAAGACATTGCAACCAGAACTCGAGTTCTGGTTGCAATGTCTTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180775    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199343.1-62s1c1
Sequence:CCGGGAGTTCTCAAGAGAGACCGATCTCGAGATCGGTCTCTCTTGAGAACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180989    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_199343.1-67s1c1
Sequence:CCGGCTCAAGAGAGACCGATCAGAACTCGAGTTCTGATCGGTCTCTCTTGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)