EMAIL THIS PAGE TO A FRIEND

NF1

neurofibromin 1

215 Gene Product Result for
Synonyms: NFNS VRNF WSS
UniProtKB ID: P21359, O00662, Q14284, Q14930, Q14931, Q9UMK3
Gene ID:
Human(4763) Summary: This gene product appears to function as a negative regulator of the ras signal transduction pathway. Mutations in this gene have been linked to neurofibromatosis type 1, juvenile myelomonocytic leukemia and Watson syndrome. The mRNA for this gene is subject to RNA editing (CGA>UGA->Arg1306Term) resulting in premature translation termination. Alternatively spliced transcript variants encoding different isoforms have also been described for this gene. [provided by RefSeq, Jul 2008]
Mouse(18015) neurofibromatosis 1
Rat(24592) neurofibromin 1
fruit fly(43149) Neurofibromin 1
cow(280877) neurofibromin 1
cow(531372) neurofibromin 1
Horse(100071896) neurofibromin 1
domestic cat(493675) neurofibromin 1
domestic cat(101092407) neurofibromin 1
dog(480618) neurofibromin 1
chicken(396085) neurofibromin 1
sheep(101117432) neurofibromin 1
naked mole-rat(101719382) neurofibromin 1
Domestic Rabbit(100349438) neurofibromin 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000267 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000267 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000267 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010897 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010897 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010897 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000267 siRNAs that have been validated in the lab human pricing
NM_001042492 Rosetta Predictions human pricing
NM_001128147 Rosetta Predictions human pricing
NM_012609 Rosetta Predictions rat pricing
NM_010897 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000267 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00129008 validated 1184
1 SASI_Hs01_00129006 validated 1099
2 SASI_Hs02_00302218 predicted 5408
3 SASI_Hs01_00129007 predicted 8166
4 SASI_Hs02_00302219 predicted 4749
5 SASI_Hs01_00129009 predicted 2938
6 SASI_Hs01_00129010 predicted 938
7 SASI_Hs02_00302220 predicted 764
8 SASI_Hs01_00129011 predicted 5839
9 SASI_Hs01_00129013 predicted 4726
10 SASI_Hs01_00129012 predicted 1435
11 SASI_Hs01_00129014 predicted 4860
12 SASI_Hs01_00129015 predicted 7003
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042492 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00310128 predicted 5470
2 SASI_Hs02_00310129 predicted 1098
3 SASI_Hs02_00310130 predicted 8233
4 SASI_Hs02_00310131 predicted 1182
5 SASI_Hs02_00310132 predicted 4811
6 SASI_Hs02_00310133 predicted 2946
7 SASI_Hs02_00310134 predicted 938
8 SASI_Hs02_00310135 predicted 768
9 SASI_Hs02_00310136 predicted 5899
10 SASI_Hs02_00310137 predicted 4782
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001128147 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00330576 predicted 1093
2 SASI_Hs02_00330577 predicted 1181
3 SASI_Hs02_00330578 predicted 1833
4 SASI_Hs02_00330579 predicted 1486
5 SASI_Hs02_00330580 predicted 1043
6 SASI_Hs02_00330581 predicted 934
7 SASI_Hs02_00330582 predicted 860
8 SASI_Hs02_00330583 predicted 764
9 SASI_Hs02_00330584 predicted 1791
10 SASI_Hs02_00330585 predicted 1223
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012609 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00052634 predicted 3265
2 SASI_Rn01_00052635 predicted 2974
3 SASI_Rn02_00259795 predicted 3140
4 SASI_Rn01_00052636 predicted 7238
5 SASI_Rn01_00052637 predicted 3434
6 SASI_Rn01_00052640 predicted 754
7 SASI_Rn01_00052641 predicted 1082
8 SASI_Rn01_00052643 predicted 6832
9 SASI_Rn02_00259796 predicted 1405
10 SASI_Rn02_00259797 predicted 6929
11 SASI_Rn01_00052638 predicted 2877
12 SASI_Rn01_00052639 predicted 7106
13 SASI_Rn01_00052642 predicted 8631
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010897 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00319613 predicted 2169
2 SASI_Mm01_00112788 predicted 7278
3 SASI_Mm01_00112789 predicted 1093
4 SASI_Mm01_00112790 predicted 2944
5 SASI_Mm01_00112787 predicted 3413
6 SASI_Mm02_00319614 predicted 3120
7 SASI_Mm01_00112791 predicted 5741
8 SASI_Mm01_00112793 predicted 3639
9 SASI_Mm01_00112794 predicted 6864
10 SASI_Mm02_00319615 predicted 7389
11 SASI_Mm01_00112792 predicted 8443
12 SASI_Mm01_00112795 predicted 6683
13 SASI_Mm01_00112796 predicted 5032
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000267
VALIDATED
NF1 MISSION shRNA Bacterial Glycerol Stock
neurofibromin 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000039716    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_000267.1-6992s1c1
Sequence:CCGGCCTGACACTTACAACAGTCAACTCGAGTTGACTGTTGTAAGTGTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039713    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_000267.1-8750s1c1
Sequence:CCGGCCATGTTGTAATGCTGCACTTCTCGAGAAGTGCAGCATTACAACATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039717    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000267.1-8627s1c1
Sequence:CCGGGCTGGCAGTTTCAAACGTAATCTCGAGATTACGTTTGAAACTGCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238778    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_000267.2-954s21c1
Sequence:CCGGTGCGCAGTTAGCAGTTATAAACTCGAGTTTATAACTGCTAACTGCGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234916    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_000267.2-5875s21c1
Sequence:CCGGTTACGGTCAGCTGCCTATAATCTCGAGATTATAGGCAGCTGACCGTAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234918    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_000267.2-8944s21c1
Sequence:CCGGCTTCGAAGCCTTGCCTAAATTCTCGAGAATTTAGGCAAGGCTTCGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234917    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_000267.2-7302s21c1
Sequence:CCGGTTTAGATAGTCTCCGTATATTCTCGAGAATATACGGAGACTATCTAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234915    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000267.2-497s21c1
Sequence:CCGGTAAGCGGCCTCACTACTATTTCTCGAGAAATAGTAGTGAGGCCGCTTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000267
VALIDATED
NF1 MISSION shRNA shRNA Plasmid DNA
neurofibromin 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000039716    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_000267.1-6992s1c1
Sequence:CCGGCCTGACACTTACAACAGTCAACTCGAGTTGACTGTTGTAAGTGTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039713    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_000267.1-8750s1c1
Sequence:CCGGCCATGTTGTAATGCTGCACTTCTCGAGAAGTGCAGCATTACAACATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039717    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000267.1-8627s1c1
Sequence:CCGGGCTGGCAGTTTCAAACGTAATCTCGAGATTACGTTTGAAACTGCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238778    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_000267.2-954s21c1
Sequence:CCGGTGCGCAGTTAGCAGTTATAAACTCGAGTTTATAACTGCTAACTGCGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234916    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_000267.2-5875s21c1
Sequence:CCGGTTACGGTCAGCTGCCTATAATCTCGAGATTATAGGCAGCTGACCGTAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234918    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_000267.2-8944s21c1
Sequence:CCGGCTTCGAAGCCTTGCCTAAATTCTCGAGAATTTAGGCAAGGCTTCGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234917    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_000267.2-7302s21c1
Sequence:CCGGTTTAGATAGTCTCCGTATATTCTCGAGAATATACGGAGACTATCTAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234915    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000267.2-497s21c1
Sequence:CCGGTAAGCGGCCTCACTACTATTTCTCGAGAAATAGTAGTGAGGCCGCTTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000267
VALIDATED
NF1 MISSION shRNA Lentiviral Transduction Particles
neurofibromin 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000039716    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_000267.1-6992s1c1
Sequence:CCGGCCTGACACTTACAACAGTCAACTCGAGTTGACTGTTGTAAGTGTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039713    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_000267.1-8750s1c1
Sequence:CCGGCCATGTTGTAATGCTGCACTTCTCGAGAAGTGCAGCATTACAACATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039717    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000267.1-8627s1c1
Sequence:CCGGGCTGGCAGTTTCAAACGTAATCTCGAGATTACGTTTGAAACTGCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238778    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_000267.2-954s21c1
Sequence:CCGGTGCGCAGTTAGCAGTTATAAACTCGAGTTTATAACTGCTAACTGCGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234916    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_000267.2-5875s21c1
Sequence:CCGGTTACGGTCAGCTGCCTATAATCTCGAGATTATAGGCAGCTGACCGTAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234918    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_000267.2-8944s21c1
Sequence:CCGGCTTCGAAGCCTTGCCTAAATTCTCGAGAATTTAGGCAAGGCTTCGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234917    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_000267.2-7302s21c1
Sequence:CCGGTTTAGATAGTCTCCGTATATTCTCGAGAATATACGGAGACTATCTAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234915    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000267.2-497s21c1
Sequence:CCGGTAAGCGGCCTCACTACTATTTCTCGAGAAATAGTAGTGAGGCCGCTTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010897
NF1 MISSION shRNA Bacterial Glycerol Stock
neurofibromin 1
Mouse
2 Products Total
TRC Number Price Set Price (2)? Select
TRCN0000034341    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010897.1-7493s1c1
Sequence:CCGGCCCTTCTTCTTACTGATATTTCTCGAGAAATATCAGTAAGAAGAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034343    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010897.1-2168s1c1
Sequence:CCGGCCAAGCTAGAAGTGGCCTTATCTCGAGATAAGGCCACTTCTAGCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010897
NF1 MISSION shRNA shRNA Plasmid DNA
neurofibromin 1
Mouse
2 Products Total
TRC Number Vector Price Set Price (2)? Select
TRCN0000034341    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010897.1-7493s1c1
Sequence:CCGGCCCTTCTTCTTACTGATATTTCTCGAGAAATATCAGTAAGAAGAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034343    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010897.1-2168s1c1
Sequence:CCGGCCAAGCTAGAAGTGGCCTTATCTCGAGATAAGGCCACTTCTAGCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010897
NF1 MISSION shRNA Lentiviral Transduction Particles
neurofibromin 1
Mouse
2 Products Total
TRC Number Volume Titer Vector Price Set Price (2)? Select
TRCN0000034341    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010897.1-7493s1c1
Sequence:CCGGCCCTTCTTCTTACTGATATTTCTCGAGAAATATCAGTAAGAAGAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034343    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010897.1-2168s1c1
Sequence:CCGGCCAAGCTAGAAGTGGCCTTATCTCGAGATAAGGCCACTTCTAGCTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)