EMAIL THIS PAGE TO A FRIEND

NF2

neurofibromin 2 (merlin)

309 Gene Product Result for
Synonyms: ACN BANF SCH
Gene ID:
Human(4771) Summary: This gene encodes a protein that is similar to some members of the ERM (ezrin, radixin, moesin) family of proteins that are thought to link cytoskeletal components with proteins in the cell membrane. This gene product has been shown to interact with cell-surface proteins, proteins involved in cytoskeletal dynamics and proteins involved in regulating ion transport. This gene is expressed at high levels during embryonic development; in adults, significant expression is found in Schwann cells, meningeal cells, lens and nerve. Mutations in this gene are associated with neurofibromatosis type II which is characterized by nervous system and skin tumors and ocular abnormalities. Two predominant isoforms and a number of minor isoforms are produced by alternatively spliced transcripts. [provided by RefSeq, Jul 2008]
Mouse(18016) neurofibromatosis 2
Rat(25744) neurofibromin 2 (merlin)
chicken(395158) neurofibromin 2 (bilateral acoustic neuroma)
dog(477535) neurofibromin 2 (merlin)
domestic cat(101087787) neurofibromin 2 (merlin)
cow(540479) neurofibromin 2 (merlin)
Horse(100058977) neurofibromin 2 (merlin)
Domestic Rabbit(100357691) neurofibromin 2 (merlin)
naked mole-rat(101706100) neurofibromin 2 (merlin)
domestic guinea pig(100715365) neurofibromin 2 (merlin)
sheep(101107995) neurofibromin 2 (merlin)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010898 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010898 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010898 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000268 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000268 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000268 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU095701 MISSION® esiRNA esiRNA human NF2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000268 Rosetta Predictions human pricing
NM_016418 Rosetta Predictions human pricing
NM_181825 Rosetta Predictions human pricing
NM_181826 Rosetta Predictions human pricing
NM_181827 Rosetta Predictions human pricing
NM_181828 Rosetta Predictions human pricing
NM_181829 Rosetta Predictions human pricing
NM_181830 Rosetta Predictions human pricing
NM_181831 Rosetta Predictions human pricing
NM_181832 Rosetta Predictions human pricing
NM_181833 Rosetta Predictions human pricing
NM_181834 Rosetta Predictions human pricing
NM_181835 Rosetta Predictions human pricing
NM_013193 Rosetta Predictions rat pricing
NM_010898 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000268 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00188860 predicted 1248
2 SASI_Hs01_00188861 predicted 1208
3 SASI_Hs01_00188862 predicted 1301
4 SASI_Hs01_00188863 predicted 1747
5 SASI_Hs01_00188864 predicted 1668
6 SASI_Hs01_00188865 predicted 1325
7 SASI_Hs01_00188866 predicted 954
8 SASI_Hs01_00188867 predicted 699
9 SASI_Hs01_00188868 predicted 1346
10 SASI_Hs01_00188869 predicted 779
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016418 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00110540 predicted 1241
2 SASI_Hs01_00110541 predicted 1214
3 SASI_Hs01_00110542 predicted 1302
4 SASI_Hs01_00110543 predicted 1750
5 SASI_Hs01_00110544 predicted 1672
6 SASI_Hs01_00110545 predicted 1321
7 SASI_Hs01_00110546 predicted 952
8 SASI_Hs01_00110547 predicted 697
9 SASI_Hs01_00110548 predicted 1350
10 SASI_Hs01_00110549 predicted 777
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181825 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00205048 predicted 1243
2 SASI_Hs01_00205049 predicted 1214
3 SASI_Hs01_00205050 predicted 2238
4 SASI_Hs01_00205051 predicted 1299
5 SASI_Hs01_00205052 predicted 1749
6 SASI_Hs01_00205053 predicted 1674
7 SASI_Hs01_00205054 predicted 1325
8 SASI_Hs01_00205055 predicted 955
9 SASI_Hs01_00205056 predicted 706
10 SASI_Hs01_00205057 predicted 1351
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181826 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00148545 predicted 866
2 SASI_Hs01_00148546 predicted 702
3 SASI_Hs01_00148547 predicted 811
4 SASI_Hs01_00148548 predicted 483
5 SASI_Hs01_00148549 predicted 1054
6 SASI_Hs01_00148550 predicted 801
7 SASI_Hs01_00148551 predicted 884
8 SASI_Hs01_00148552 predicted 468
9 SASI_Hs01_00148553 predicted 870
10 SASI_Hs01_00148554 predicted 1065
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181827 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00033039 predicted 676
2 SASI_Hs01_00033040 predicted 781
3 SASI_Hs01_00033041 predicted 593
4 SASI_Hs01_00033042 predicted 1133
5 SASI_Hs01_00033043 predicted 720
6 SASI_Hs01_00033044 predicted 483
7 SASI_Hs01_00033045 predicted 969
8 SASI_Hs01_00033046 predicted 716
9 SASI_Hs01_00033047 predicted 794
10 SASI_Hs01_00033048 predicted 469
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181828 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00028116 predicted 1120
2 SASI_Hs01_00028117 predicted 1089
3 SASI_Hs01_00028118 predicted 1171
4 SASI_Hs01_00028119 predicted 1621
5 SASI_Hs01_00028120 predicted 1546
6 SASI_Hs01_00028121 predicted 1191
7 SASI_Hs01_00028122 predicted 824
8 SASI_Hs01_00028123 predicted 576
9 SASI_Hs01_00028124 predicted 1226
10 SASI_Hs01_00028125 predicted 651
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181829 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00103881 predicted 1119
2 SASI_Hs01_00103882 predicted 1091
3 SASI_Hs01_00103883 predicted 1173
4 SASI_Hs01_00103884 predicted 1625
5 SASI_Hs01_00103885 predicted 1172
6 SASI_Hs01_00103886 predicted 1544
7 SASI_Hs01_00103887 predicted 1193
8 SASI_Hs01_00103888 predicted 828
9 SASI_Hs01_00103889 predicted 1221
10 SASI_Hs01_00103890 predicted 838
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181830 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00163415 predicted 993
2 SASI_Hs01_00163416 predicted 958
3 SASI_Hs01_00163417 predicted 1052
4 SASI_Hs01_00163418 predicted 1495
5 SASI_Hs01_00163419 predicted 1046
6 SASI_Hs01_00163420 predicted 1417
7 SASI_Hs01_00163421 predicted 1074
8 SASI_Hs01_00163422 predicted 702
9 SASI_Hs01_00163423 predicted 1098
10 SASI_Hs01_00163424 predicted 717
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181831 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00010323 predicted 997
2 SASI_Hs01_00010325 predicted 2012
3 SASI_Hs01_00010326 predicted 1050
4 SASI_Hs01_00010327 predicted 1502
5 SASI_Hs02_00370420 predicted 1047
6 SASI_Hs01_00010328 predicted 1417
7 SASI_Hs01_00010329 predicted 1075
8 SASI_Hs01_00010330 predicted 703
9 SASI_Hs01_00010331 predicted 1102
10 SASI_Hs01_00010332 predicted 713
11 SASI_Hs01_00010324 predicted 951
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181832 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00217526 predicted 1248
2 SASI_Hs01_00217527 predicted 1210
3 SASI_Hs01_00217528 predicted 1297
4 SASI_Hs01_00217529 predicted 1744
5 SASI_Hs01_00217530 predicted 1667
6 SASI_Hs01_00217531 predicted 1318
7 SASI_Hs01_00217532 predicted 950
8 SASI_Hs01_00217533 predicted 701
9 SASI_Hs01_00217534 predicted 1352
10 SASI_Hs01_00217535 predicted 779
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181833 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00139801 predicted 607
2 SASI_Hs01_00139802 predicted 707
3 SASI_Hs01_00139803 predicted 616
4 SASI_Hs01_00139804 predicted 498
5 SASI_Hs01_00139806 predicted 1155
6 SASI_Hs01_00139807 predicted 704
7 SASI_Hs01_00139808 predicted 1134
8 SASI_Hs01_00139809 predicted 780
9 SASI_Hs02_00370421 predicted 485
10 SASI_Hs02_00370422 predicted 768
11 SASI_Hs01_00139800 predicted 758
12 SASI_Hs01_00139805 predicted 1160
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181834 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00140716 predicted 757
2 SASI_Hs01_00140717 predicted 722
3 SASI_Hs01_00140718 predicted 802
4 SASI_Hs01_00140719 predicted 833
5 SASI_Hs01_00140720 predicted 857
6 SASI_Hs01_00140721 predicted 1420
7 SASI_Hs01_00140722 predicted 521
8 SASI_Hs01_00140723 predicted 530
9 SASI_Hs01_00140724 predicted 747
10 SASI_Hs01_00140725 predicted 1123
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181835 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00180477 predicted 538
2 SASI_Hs01_00180478 predicted 965
3 SASI_Hs01_00180479 predicted 663
4 SASI_Hs01_00180480 predicted 943
5 SASI_Hs01_00180481 predicted 685
6 SASI_Hs01_00180482 predicted 1460
7 SASI_Hs01_00180483 predicted 763
8 SASI_Hs01_00180484 predicted 948
9 SASI_Hs01_00180485 predicted 1034
10 SASI_Hs01_00180486 predicted 1074
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013193 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00261053 predicted 1076
2 SASI_Rn02_00261054 predicted 905
3 SASI_Rn02_00261055 predicted 1270
4 SASI_Rn02_00261056 predicted 1322
5 SASI_Rn02_00261057 predicted 1873
6 SASI_Rn02_00261058 predicted 1617
7 SASI_Rn02_00261059 predicted 1210
8 SASI_Rn02_00261060 predicted 1164
9 SASI_Rn02_00261061 predicted 2153
10 SASI_Rn02_00261062 predicted 1993
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010898 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00154224 predicted 796
2 SASI_Mm01_00154225 predicted 1055
3 SASI_Mm01_00154226 predicted 2253
4 SASI_Mm02_00319616 predicted 1848
5 SASI_Mm01_00154228 predicted 969
6 SASI_Mm01_00154229 predicted 1348
7 SASI_Mm01_00154230 predicted 2077
8 SASI_Mm01_00154231 predicted 1311
9 SASI_Mm01_00154232 predicted 866
10 SASI_Mm01_00154233 predicted 1771
11 SASI_Mm01_00154227 predicted 2051
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010898
VALIDATED
NF2 MISSION shRNA Bacterial Glycerol Stock
neurofibromin 2 (merlin)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000311589    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010898.3-2411s21c1
Sequence:CCGGAGTAGAGGGCTGGCTTGTTTGCTCGAGCAAACAAGCCAGCCCTCTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042519    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010898.2-2291s1c1
Sequence:CCGGGCAGCAAGCATAATACCATTACTCGAGTAATGGTATTATGCTTGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042520    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010898.2-1989s1c1
Sequence:CCGGGCTCTTAGAAATCGCCACCAACTCGAGTTGGTGGCGATTTCTAAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042521    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010898.2-1491s1c1
Sequence:CCGGCCTATTTATGAGGCGACGGAACTCGAGTTCCGTCGCCTCATAAATAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042522    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010898.2-1069s1c1
Sequence:CCGGCAAGAGGAATTGCTCCCGAAACTCGAGTTTCGGGAGCAATTCCTCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327245    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010898.3-1457s21c1
Sequence:CCGGCCTATTTATGAGGCGACGGAACTCGAGTTCCGTCGCCTCATAAATAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010898.2-1623s1c1
Sequence:CCGGCGAGCGTACAAGAGATGAGTTCTCGAGAACTCATCTCTTGTACGCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327319    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010898.3-1955s21c1
Sequence:CCGGGCTCTTAGAAATCGCCACCAACTCGAGTTGGTGGCGATTTCTAAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311587    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010898.3-2023s21c1
Sequence:CCGGACATACCGAGCTTCGACATTACTCGAGTAATGTCGAAGCTCGGTATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327288    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010898.3-2257s21c1
Sequence:CCGGGCAGCAAGCATAATACCATTACTCGAGTAATGGTATTATGCTTGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010898
VALIDATED
NF2 MISSION shRNA shRNA Plasmid DNA
neurofibromin 2 (merlin)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000311589    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010898.3-2411s21c1
Sequence:CCGGAGTAGAGGGCTGGCTTGTTTGCTCGAGCAAACAAGCCAGCCCTCTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042519    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010898.2-2291s1c1
Sequence:CCGGGCAGCAAGCATAATACCATTACTCGAGTAATGGTATTATGCTTGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042520    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010898.2-1989s1c1
Sequence:CCGGGCTCTTAGAAATCGCCACCAACTCGAGTTGGTGGCGATTTCTAAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042521    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010898.2-1491s1c1
Sequence:CCGGCCTATTTATGAGGCGACGGAACTCGAGTTCCGTCGCCTCATAAATAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042522    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010898.2-1069s1c1
Sequence:CCGGCAAGAGGAATTGCTCCCGAAACTCGAGTTTCGGGAGCAATTCCTCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000327245    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010898.3-1457s21c1
Sequence:CCGGCCTATTTATGAGGCGACGGAACTCGAGTTCCGTCGCCTCATAAATAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010898.2-1623s1c1
Sequence:CCGGCGAGCGTACAAGAGATGAGTTCTCGAGAACTCATCTCTTGTACGCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000327319    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010898.3-1955s21c1
Sequence:CCGGGCTCTTAGAAATCGCCACCAACTCGAGTTGGTGGCGATTTCTAAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000311587    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010898.3-2023s21c1
Sequence:CCGGACATACCGAGCTTCGACATTACTCGAGTAATGTCGAAGCTCGGTATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000327288    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010898.3-2257s21c1
Sequence:CCGGGCAGCAAGCATAATACCATTACTCGAGTAATGGTATTATGCTTGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010898
VALIDATED
NF2 MISSION shRNA Lentiviral Transduction Particles
neurofibromin 2 (merlin)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000311589    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010898.3-2411s21c1
Sequence:CCGGAGTAGAGGGCTGGCTTGTTTGCTCGAGCAAACAAGCCAGCCCTCTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042519    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010898.2-2291s1c1
Sequence:CCGGGCAGCAAGCATAATACCATTACTCGAGTAATGGTATTATGCTTGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042520    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010898.2-1989s1c1
Sequence:CCGGGCTCTTAGAAATCGCCACCAACTCGAGTTGGTGGCGATTTCTAAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042521    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010898.2-1491s1c1
Sequence:CCGGCCTATTTATGAGGCGACGGAACTCGAGTTCCGTCGCCTCATAAATAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042522    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010898.2-1069s1c1
Sequence:CCGGCAAGAGGAATTGCTCCCGAAACTCGAGTTTCGGGAGCAATTCCTCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327245    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010898.3-1457s21c1
Sequence:CCGGCCTATTTATGAGGCGACGGAACTCGAGTTCCGTCGCCTCATAAATAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010898.2-1623s1c1
Sequence:CCGGCGAGCGTACAAGAGATGAGTTCTCGAGAACTCATCTCTTGTACGCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327319    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010898.3-1955s21c1
Sequence:CCGGGCTCTTAGAAATCGCCACCAACTCGAGTTGGTGGCGATTTCTAAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311587    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010898.3-2023s21c1
Sequence:CCGGACATACCGAGCTTCGACATTACTCGAGTAATGTCGAAGCTCGGTATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327288    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010898.3-2257s21c1
Sequence:CCGGGCAGCAAGCATAATACCATTACTCGAGTAATGGTATTATGCTTGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000268
VALIDATED
NF2 MISSION shRNA Bacterial Glycerol Stock
neurofibromin 2 (merlin)
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000244295    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_000268.3-2157s21c1
Sequence:CCGGAGCAAGCACAATACCATTAAACTCGAGTTTAATGGTATTGTGCTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000237846    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_000268.3-5581s21c1
Sequence:CCGGCTGTGTTGTCCACCCTATTATCTCGAGATAATAGGGTGGACAACACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000237848    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_000268.3-1104s21c1
Sequence:CCGGTACTTTGCAATCCGGAATAAACTCGAGTTTATTCCGGATTGCAAAGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000237847    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000268.3-1345s21c1
Sequence:CCGGTCGGGAACCATGATCTATTTACTCGAGTAAATAGATCATGGTTCCCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039977    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000268.2-1944s1c1
Sequence:CCGGCGACTTCAAAGATACTGACATCTCGAGATGTCAGTATCTTTGAAGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039976    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000268.2-1191s1c1
Sequence:CCGGCCCGTGGAATGAAATCCGAAACTCGAGTTTCGGATTTCATTCCACGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039975    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000268.2-1290s1c1
Sequence:CCGGGCTTCGTGTTAATAAGCTGATCTCGAGATCAGCTTATTAACACGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039974    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000268.2-2092s1c1
Sequence:CCGGGCTCTGGATATTCTGCACAATCTCGAGATTGTGCAGAATATCCAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039973    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000268.2-4648s1c1
Sequence:CCGGCGGGCTTTGTTTCCTTCTTTACTCGAGTAAAGAAGGAAACAAAGCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018338    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000268.x-2467s1c1
Sequence:CCGGTAGTTCTCTGACCTGAGTCTTCTCGAGAAGACTCAGGTCAGAGAACTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000237845    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_000268.3-1245s21c1
Sequence:CCGGGACAAGGAGTTTACTATTAAACTCGAGTTTAATAGTAAACTCCTTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010398    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000268.x-1907s1c1
Sequence:CCGGCATACCAAGCTTCAACCTCATCTCGAGATGAGGTTGAAGCTTGGTATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000268.x-473s1c1
Sequence:CCGGAAGCAACCCAAGACGTTCACCTCGAGGTGAACGTCTTGGGTTGCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000268
VALIDATED
NF2 MISSION shRNA shRNA Plasmid DNA
neurofibromin 2 (merlin)
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000244295    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_000268.3-2157s21c1
Sequence:CCGGAGCAAGCACAATACCATTAAACTCGAGTTTAATGGTATTGTGCTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000237846    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_000268.3-5581s21c1
Sequence:CCGGCTGTGTTGTCCACCCTATTATCTCGAGATAATAGGGTGGACAACACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000237848    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_000268.3-1104s21c1
Sequence:CCGGTACTTTGCAATCCGGAATAAACTCGAGTTTATTCCGGATTGCAAAGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000237847    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000268.3-1345s21c1
Sequence:CCGGTCGGGAACCATGATCTATTTACTCGAGTAAATAGATCATGGTTCCCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039977    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000268.2-1944s1c1
Sequence:CCGGCGACTTCAAAGATACTGACATCTCGAGATGTCAGTATCTTTGAAGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039976    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000268.2-1191s1c1
Sequence:CCGGCCCGTGGAATGAAATCCGAAACTCGAGTTTCGGATTTCATTCCACGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039975    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000268.2-1290s1c1
Sequence:CCGGGCTTCGTGTTAATAAGCTGATCTCGAGATCAGCTTATTAACACGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039974    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000268.2-2092s1c1
Sequence:CCGGGCTCTGGATATTCTGCACAATCTCGAGATTGTGCAGAATATCCAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039973    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000268.2-4648s1c1
Sequence:CCGGCGGGCTTTGTTTCCTTCTTTACTCGAGTAAAGAAGGAAACAAAGCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018338    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000268.x-2467s1c1
Sequence:CCGGTAGTTCTCTGACCTGAGTCTTCTCGAGAAGACTCAGGTCAGAGAACTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000237845    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_000268.3-1245s21c1
Sequence:CCGGGACAAGGAGTTTACTATTAAACTCGAGTTTAATAGTAAACTCCTTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010398    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000268.x-1907s1c1
Sequence:CCGGCATACCAAGCTTCAACCTCATCTCGAGATGAGGTTGAAGCTTGGTATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000268.x-473s1c1
Sequence:CCGGAAGCAACCCAAGACGTTCACCTCGAGGTGAACGTCTTGGGTTGCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000268
VALIDATED
NF2 MISSION shRNA Lentiviral Transduction Particles
neurofibromin 2 (merlin)
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000244295    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_000268.3-2157s21c1
Sequence:CCGGAGCAAGCACAATACCATTAAACTCGAGTTTAATGGTATTGTGCTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000237846    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_000268.3-5581s21c1
Sequence:CCGGCTGTGTTGTCCACCCTATTATCTCGAGATAATAGGGTGGACAACACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000237848    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_000268.3-1104s21c1
Sequence:CCGGTACTTTGCAATCCGGAATAAACTCGAGTTTATTCCGGATTGCAAAGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000237847    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000268.3-1345s21c1
Sequence:CCGGTCGGGAACCATGATCTATTTACTCGAGTAAATAGATCATGGTTCCCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039977    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000268.2-1944s1c1
Sequence:CCGGCGACTTCAAAGATACTGACATCTCGAGATGTCAGTATCTTTGAAGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039976    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000268.2-1191s1c1
Sequence:CCGGCCCGTGGAATGAAATCCGAAACTCGAGTTTCGGATTTCATTCCACGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039975    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000268.2-1290s1c1
Sequence:CCGGGCTTCGTGTTAATAAGCTGATCTCGAGATCAGCTTATTAACACGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039974    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000268.2-2092s1c1
Sequence:CCGGGCTCTGGATATTCTGCACAATCTCGAGATTGTGCAGAATATCCAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039973    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000268.2-4648s1c1
Sequence:CCGGCGGGCTTTGTTTCCTTCTTTACTCGAGTAAAGAAGGAAACAAAGCCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018338    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000268.x-2467s1c1
Sequence:CCGGTAGTTCTCTGACCTGAGTCTTCTCGAGAAGACTCAGGTCAGAGAACTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000237845    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_000268.3-1245s21c1
Sequence:CCGGGACAAGGAGTTTACTATTAAACTCGAGTTTAATAGTAAACTCCTTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010398    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000268.x-1907s1c1
Sequence:CCGGCATACCAAGCTTCAACCTCATCTCGAGATGAGGTTGAAGCTTGGTATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000268.x-473s1c1
Sequence:CCGGAAGCAACCCAAGACGTTCACCTCGAGGTGAACGTCTTGGGTTGCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)