EMAIL THIS PAGE TO A FRIEND

NFAM1

NFAT activating protein with ITAM motif 1

65 Gene Product Result for
Synonyms: CNAIP bK126B4.4
UniProtKB ID: Q8NET5, B0QYD0, Q20WL2, Q5JZ96, Q8IUY8, Q8TEM8
Gene ID:
Human(150372) Summary: The protein encoded by this gene is a type I membrane receptor that activates cytokine gene promoters such as the IL-13 and TNF-alpha promoters. The encoded protein contains an immunoreceptor tyrosine-based activation motif (ITAM) and is thought to regulate the signaling and development of B-cells. [provided by RefSeq, Jul 2008]
Mouse(74039) Nfat activating molecule with ITAM motif 1
Rat(362966) NFAT activating protein with ITAM motif 1
chicken(417979) NFAT activating protein with ITAM motif 1
dog(609583) NFAT activating protein with ITAM motif 1
domestic cat(101090879) NFAT activating protein with ITAM motif 1
cow(512151) NFAT activating protein with ITAM motif 1
sheep(101105904) NFAT activating protein with ITAM motif 1
domestic guinea pig(100725032) NFAT activating protein with ITAM motif 1
naked mole-rat(101720756) NFAT activating protein with ITAM motif 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145912 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_145912 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_145912 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028728 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028728 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028728 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU074391 MISSION® esiRNA esiRNA targeting mouse Nfam1 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_145912 Rosetta Predictions human pricing
XM_001077695 Rosetta Predictions rat pricing
XM_343297 Rosetta Predictions rat pricing
NM_028728 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145912 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00146942 predicted 674
2 SASI_Hs01_00146943 predicted 268
3 SASI_Hs01_00146944 predicted 724
4 SASI_Hs01_00146945 predicted 471
5 SASI_Hs01_00146946 predicted 417
6 SASI_Hs01_00146947 predicted 478
7 SASI_Hs01_00146948 predicted 301
8 SASI_Hs01_00146949 predicted 453
9 SASI_Hs01_00146950 predicted 274
10 SASI_Hs01_00146951 predicted 632
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001077695 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00358144 predicted 857
2 SASI_Rn02_00358145 predicted 522
3 SASI_Rn02_00358146 predicted 771
4 SASI_Rn02_00358147 predicted 789
5 SASI_Rn02_00358148 predicted 381
6 SASI_Rn02_00358149 predicted 417
7 SASI_Rn02_00358150 predicted 327
8 SASI_Rn02_00358151 predicted 648
9 SASI_Rn02_00358152 predicted 534
10 SASI_Rn02_00358153 predicted 555
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_343297 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00395603 predicted 854
2 SASI_Rn02_00395604 predicted 528
3 SASI_Rn02_00395605 predicted 778
4 SASI_Rn02_00395606 predicted 785
5 SASI_Rn02_00395607 predicted 379
6 SASI_Rn02_00395608 predicted 410
7 SASI_Rn02_00395609 predicted 323
8 SASI_Rn02_00395610 predicted 652
9 SASI_Rn02_00395611 predicted 536
10 SASI_Rn02_00395612 predicted 547
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028728 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00191353 predicted 780
2 SASI_Mm01_00191354 predicted 251
3 SASI_Mm01_00191355 predicted 1060
4 SASI_Mm01_00191357 predicted 837
5 SASI_Mm01_00191358 predicted 354
6 SASI_Mm01_00191359 predicted 659
7 SASI_Mm01_00191360 predicted 876
8 SASI_Mm02_00334292 predicted 994
9 SASI_Mm01_00191361 predicted 240
10 SASI_Mm01_00191362 predicted 575
11 SASI_Mm01_00191356 predicted 639
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145912
NFAM1 MISSION shRNA Bacterial Glycerol Stock
NFAT activating protein with ITAM motif 1
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000131128    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145912.4-1595s1c1
Sequence:CCGGGCTGGCTAAACAGGAACTGAACTCGAGTTCAGTTCCTGTTTAGCCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129393    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145912.4-721s1c1
Sequence:CCGGGTCTATGCCTGCATCGAGAATCTCGAGATTCTCGATGCAGGCATAGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145912.4-271s1c1
Sequence:CCGGGTCAGCTACTTTCATGAAGATCTCGAGATCTTCATGAAAGTAGCTGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145912.4-203s1c1
Sequence:CCGGCCAACACAGCTATCTCCTTCACTCGAGTGAAGGAGATAGCTGTGTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145912.4-816s1c1
Sequence:CCGGCGAACTTAACCTGGTCTATGACTCGAGTCATAGACCAGGTTAAGTTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145912.4-804s1c1
Sequence:CCGGCGAAGATGATGGCGAACTTAACTCGAGTTAAGTTCGCCATCATCTTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145912
NFAM1 MISSION shRNA shRNA Plasmid DNA
NFAT activating protein with ITAM motif 1
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000131128    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145912.4-1595s1c1
Sequence:CCGGGCTGGCTAAACAGGAACTGAACTCGAGTTCAGTTCCTGTTTAGCCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129393    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145912.4-721s1c1
Sequence:CCGGGTCTATGCCTGCATCGAGAATCTCGAGATTCTCGATGCAGGCATAGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145912.4-271s1c1
Sequence:CCGGGTCAGCTACTTTCATGAAGATCTCGAGATCTTCATGAAAGTAGCTGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145912.4-203s1c1
Sequence:CCGGCCAACACAGCTATCTCCTTCACTCGAGTGAAGGAGATAGCTGTGTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145912.4-816s1c1
Sequence:CCGGCGAACTTAACCTGGTCTATGACTCGAGTCATAGACCAGGTTAAGTTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145912.4-804s1c1
Sequence:CCGGCGAAGATGATGGCGAACTTAACTCGAGTTAAGTTCGCCATCATCTTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145912
NFAM1 MISSION shRNA Lentiviral Transduction Particles
NFAT activating protein with ITAM motif 1
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000131128    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145912.4-1595s1c1
Sequence:CCGGGCTGGCTAAACAGGAACTGAACTCGAGTTCAGTTCCTGTTTAGCCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129393    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145912.4-721s1c1
Sequence:CCGGGTCTATGCCTGCATCGAGAATCTCGAGATTCTCGATGCAGGCATAGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145912.4-271s1c1
Sequence:CCGGGTCAGCTACTTTCATGAAGATCTCGAGATCTTCATGAAAGTAGCTGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145912.4-203s1c1
Sequence:CCGGCCAACACAGCTATCTCCTTCACTCGAGTGAAGGAGATAGCTGTGTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145912.4-816s1c1
Sequence:CCGGCGAACTTAACCTGGTCTATGACTCGAGTCATAGACCAGGTTAAGTTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145912.4-804s1c1
Sequence:CCGGCGAAGATGATGGCGAACTTAACTCGAGTTAAGTTCGCCATCATCTTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028728
NFAM1 MISSION shRNA Bacterial Glycerol Stock
NFAT activating protein with ITAM motif 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000125884    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028728.1-1352s1c1
Sequence:CCGGGCATCAAAGAACTGCACCAAACTCGAGTTTGGTGCAGTTCTTTGATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028728.1-257s1c1
Sequence:CCGGGTTAAGTTGTTTCATACGGATCTCGAGATCCGTATGAAACAACTTAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125886    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028728.1-389s1c1
Sequence:CCGGACAGGCATTTACTACTTCATACTCGAGTATGAAGTAGTAAATGCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125885    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028728.1-787s1c1
Sequence:CCGGCAACGAATTTAACCTTGTCTACTCGAGTAGACAAGGTTAAATTCGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125888    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028728.1-388s1c1
Sequence:CCGGCACAGGCATTTACTACTTCATCTCGAGATGAAGTAGTAAATGCCTGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028728
NFAM1 MISSION shRNA shRNA Plasmid DNA
NFAT activating protein with ITAM motif 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000125884    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028728.1-1352s1c1
Sequence:CCGGGCATCAAAGAACTGCACCAAACTCGAGTTTGGTGCAGTTCTTTGATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028728.1-257s1c1
Sequence:CCGGGTTAAGTTGTTTCATACGGATCTCGAGATCCGTATGAAACAACTTAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125886    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028728.1-389s1c1
Sequence:CCGGACAGGCATTTACTACTTCATACTCGAGTATGAAGTAGTAAATGCCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125885    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028728.1-787s1c1
Sequence:CCGGCAACGAATTTAACCTTGTCTACTCGAGTAGACAAGGTTAAATTCGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125888    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028728.1-388s1c1
Sequence:CCGGCACAGGCATTTACTACTTCATCTCGAGATGAAGTAGTAAATGCCTGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028728
NFAM1 MISSION shRNA Lentiviral Transduction Particles
NFAT activating protein with ITAM motif 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000125884    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028728.1-1352s1c1
Sequence:CCGGGCATCAAAGAACTGCACCAAACTCGAGTTTGGTGCAGTTCTTTGATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028728.1-257s1c1
Sequence:CCGGGTTAAGTTGTTTCATACGGATCTCGAGATCCGTATGAAACAACTTAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125886    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028728.1-389s1c1
Sequence:CCGGACAGGCATTTACTACTTCATACTCGAGTATGAAGTAGTAAATGCCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125885    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028728.1-787s1c1
Sequence:CCGGCAACGAATTTAACCTTGTCTACTCGAGTAGACAAGGTTAAATTCGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125888    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028728.1-388s1c1
Sequence:CCGGCACAGGCATTTACTACTTCATCTCGAGATGAAGTAGTAAATGCCTGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)