EMAIL THIS PAGE TO A FRIEND

NFAT5

nuclear factor of activated T-cells 5, tonicity-responsive

467 Gene Product Result for
Synonyms: NF-AT5 NFATL1 NFATZ OREBP TONEBP
Gene ID:
Human(10725) Summary: The product of this gene is a member of the nuclear factors of activated T cells family of transcription factors. Proteins belonging to this family play a central role in inducible gene transcription during the immune response. This protein regulates gene expression induced by osmotic stress in mammalian cells. Unlike monomeric members of this protein family, this protein exists as a homodimer and forms stable dimers with DNA elements. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(54446) nuclear factor of activated T cells 5
Rat(307820) nuclear factor of activated T-cells 5, tonicity-responsive
Zebrafish(334390) nuclear factor of activated T-cells 5, tonicity-responsive
cow(538523) nuclear factor of activated T-cells 5, tonicity-responsive
Horse(100067190) nuclear factor of activated T-cells 5, tonicity-responsive
domestic cat(101097442) nuclear factor of activated T-cells 5, tonicity-responsive
dog(489734) nuclear factor of activated T-cells 5, tonicity-responsive
chicken(415866) nuclear factor of activated T-cells 5, tonicity-responsive
sheep(101113952) nuclear factor of activated T-cells 5, tonicity-responsive
sheep(780522) nuclear factor of activated T-cells 5, tonicity-responsive
domestic guinea pig(100723551) nuclear factor of activated T-cells 5, tonicity-responsive
naked mole-rat(101711867) nuclear factor of activated T-cells 5, tonicity-responsive
Domestic Rabbit(100343460) nuclear factor of activated T-cells 5, tonicity-responsive
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006599 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006599 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006599 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_018823 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_018823 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_018823 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001113178 Rosetta Predictions human pricing
NM_006599 Rosetta Predictions human pricing
NM_138713 Rosetta Predictions human pricing
NM_138714 Rosetta Predictions human pricing
NM_173214 Rosetta Predictions human pricing
NM_173215 Rosetta Predictions human pricing
NM_001107425 Rosetta Predictions rat pricing
NM_018823 Rosetta Predictions mouse pricing
NM_133957 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001113178 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00325585 predicted 5318
2 SASI_Hs02_00325586 predicted 4595
3 SASI_Hs02_00325587 predicted 5581
4 SASI_Hs02_00325588 predicted 4303
5 SASI_Hs02_00325589 predicted 3511
6 SASI_Hs02_00325590 predicted 4337
7 SASI_Hs02_00325591 predicted 1973
8 SASI_Hs02_00325592 predicted 4445
9 SASI_Hs02_00325593 predicted 5535
10 SASI_Hs02_00325594 predicted 4711
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006599 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00159933 predicted 5272
2 SASI_Hs01_00159934 predicted 4545
3 SASI_Hs01_00159935 predicted 5530
4 SASI_Hs01_00159937 predicted 4245
5 SASI_Hs01_00159939 predicted 3460
6 SASI_Hs02_00341914 predicted 4285
7 SASI_Hs02_00341915 predicted 1914
8 SASI_Hs02_00341916 predicted 4402
9 SASI_Hs02_00341917 predicted 5481
10 SASI_Hs02_00341918 predicted 4658
11 SASI_Hs01_00159932 predicted 2778
12 SASI_Hs01_00159936 predicted 2995
13 SASI_Hs01_00159938 predicted 4358
14 SASI_Hs01_00159940 predicted 1851
15 SASI_Hs01_00159941 predicted 2734
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138713 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00075296 predicted 4594
2 SASI_Hs01_00075299 predicted 4305
3 SASI_Hs01_00075301 predicted 3514
4 SASI_Hs02_00363814 predicted 4345
5 SASI_Hs02_00363815 predicted 4783
6 SASI_Hs02_00363816 predicted 1970
7 SASI_Hs02_00363817 predicted 4448
8 SASI_Hs02_00363818 predicted 4711
9 SASI_Hs02_00363819 predicted 1892
10 SASI_Hs02_00363820 predicted 4210
11 SASI_Hs01_00075294 predicted 2833
12 SASI_Hs01_00075295 predicted 5334
13 SASI_Hs01_00075297 predicted 5581
14 SASI_Hs01_00075298 predicted 3049
15 SASI_Hs01_00075300 predicted 4412
16 SASI_Hs01_00075302 predicted 1906
17 SASI_Hs01_00075303 predicted 2791
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138714 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00012242 predicted 5390
2 SASI_Hs01_00012243 predicted 4662
3 SASI_Hs01_00012244 predicted 5645
4 SASI_Hs01_00012246 predicted 4369
5 SASI_Hs01_00012248 predicted 3571
6 SASI_Hs02_00363821 predicted 4402
7 SASI_Hs02_00363822 predicted 2030
8 SASI_Hs02_00363823 predicted 4519
9 SASI_Hs02_00363824 predicted 5600
10 SASI_Hs02_00363825 predicted 4776
11 SASI_Hs01_00012241 predicted 2891
12 SASI_Hs01_00012245 predicted 3114
13 SASI_Hs01_00012247 predicted 4467
14 SASI_Hs01_00012249 predicted 1968
15 SASI_Hs01_00012250 predicted 2851
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173214 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00042323 predicted 5331
2 SASI_Hs01_00042324 predicted 4601
3 SASI_Hs01_00042325 predicted 5586
4 SASI_Hs01_00042327 predicted 4306
5 SASI_Hs01_00042329 predicted 3522
6 SASI_Hs02_00368168 predicted 4351
7 SASI_Hs02_00368169 predicted 1975
8 SASI_Hs02_00368170 predicted 4458
9 SASI_Hs02_00368171 predicted 5545
10 SASI_Hs02_00368172 predicted 4722
11 SASI_Hs01_00042322 predicted 2841
12 SASI_Hs01_00042326 predicted 3056
13 SASI_Hs01_00042328 predicted 4414
14 SASI_Hs01_00042330 predicted 1921
15 SASI_Hs01_00042331 predicted 2798
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173215 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00187346 predicted 1940
2 SASI_Hs01_00187347 predicted 4441
3 SASI_Hs01_00187348 predicted 3715
4 SASI_Hs01_00187349 predicted 4704
5 SASI_Hs01_00187350 predicted 2171
6 SASI_Hs01_00187351 predicted 3422
7 SASI_Hs01_00187352 predicted 3525
8 SASI_Hs01_00187353 predicted 2632
9 SASI_Hs01_00187354 predicted 1029
10 SASI_Hs01_00187355 predicted 1903
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107425 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00228695 predicted 2458
2 SASI_Rn02_00228696 predicted 2584
3 SASI_Rn02_00228697 predicted 1857
4 SASI_Rn02_00228698 predicted 2381
5 SASI_Rn02_00228699 predicted 5175
6 SASI_Rn02_00228700 predicted 4338
7 SASI_Rn02_00228701 predicted 2627
8 SASI_Rn02_00228702 predicted 1498
9 SASI_Rn02_00228703 predicted 2049
10 SASI_Rn02_00228704 predicted 3034
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018823 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00091445 predicted 4733
2 SASI_Mm02_00324165 predicted 3900
3 SASI_Mm02_00324166 predicted 2582
4 SASI_Mm02_00324167 predicted 3691
5 SASI_Mm02_00324168 predicted 5099
6 SASI_Mm02_00324169 predicted 1608
7 SASI_Mm02_00324170 predicted 3656
8 SASI_Mm02_00324171 predicted 4480
9 SASI_Mm02_00324172 predicted 1046
10 SASI_Mm02_00324173 predicted 1937
11 SASI_Mm01_00091444 predicted 4310
12 SASI_Mm01_00091446 predicted 4335
13 SASI_Mm01_00091447 predicted 4387
14 SASI_Mm01_00091448 predicted 4327
15 SASI_Mm01_00091449 predicted 2971
16 SASI_Mm01_00091450 predicted 4392
17 SASI_Mm01_00091451 predicted 4310
18 SASI_Mm01_00091452 predicted 4324
19 SASI_Mm01_00091453 predicted 4383
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133957 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00200831 predicted 4799
2 SASI_Mm02_00339067 predicted 3955
3 SASI_Mm02_00339068 predicted 2648
4 SASI_Mm02_00339069 predicted 3750
5 SASI_Mm02_00339070 predicted 5163
6 SASI_Mm02_00339071 predicted 1666
7 SASI_Mm02_00339072 predicted 3714
8 SASI_Mm02_00339073 predicted 4538
9 SASI_Mm02_00339074 predicted 1112
10 SASI_Mm02_00339075 predicted 2000
11 SASI_Mm01_00200830 predicted 4345
12 SASI_Mm01_00200832 predicted 4367
13 SASI_Mm01_00200833 predicted 4429
14 SASI_Mm01_00200834 predicted 4354
15 SASI_Mm01_00200835 predicted 3002
16 SASI_Mm01_00200836 predicted 4431
17 SASI_Mm01_00200837 predicted 4346
18 SASI_Mm01_00200838 predicted 4356
19 SASI_Mm01_00200839 predicted 4424
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006599
NFAT5 MISSION shRNA Bacterial Glycerol Stock
nuclear factor of activated T-cells 5, tonicity-responsive
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000437810    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006599.2-2352s21c1
Sequence:CCGGGTGGACTGCGTAGGGATATTGCTCGAGCAATATCCCTACGCAGTCCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006599.2-4698s1c1
Sequence:CCGGCCGAACTCAATTTCTCCACTTCTCGAGAAGTGGAGAAATTGAGTTCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006599.2-3470s1c1
Sequence:CCGGGCAGCAGATTTCATCAAATATCTCGAGATATTTGATGAAATCTGCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020023    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006599.2-1933s1c1
Sequence:CCGGCGGACAACAAAGGCAACTCAACTCGAGTTGAGTTGCCTTTGTTGTCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006599.2-3933s1c1
Sequence:CCGGGCCCAGATTCAGTCAGAGTTACTCGAGTAACTCTGACTGAATCTGGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006599
NFAT5 MISSION shRNA shRNA Plasmid DNA
nuclear factor of activated T-cells 5, tonicity-responsive
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000437810    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006599.2-2352s21c1
Sequence:CCGGGTGGACTGCGTAGGGATATTGCTCGAGCAATATCCCTACGCAGTCCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006599.2-4698s1c1
Sequence:CCGGCCGAACTCAATTTCTCCACTTCTCGAGAAGTGGAGAAATTGAGTTCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006599.2-3470s1c1
Sequence:CCGGGCAGCAGATTTCATCAAATATCTCGAGATATTTGATGAAATCTGCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020023    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006599.2-1933s1c1
Sequence:CCGGCGGACAACAAAGGCAACTCAACTCGAGTTGAGTTGCCTTTGTTGTCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006599.2-3933s1c1
Sequence:CCGGGCCCAGATTCAGTCAGAGTTACTCGAGTAACTCTGACTGAATCTGGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006599
NFAT5 MISSION shRNA Lentiviral Transduction Particles
nuclear factor of activated T-cells 5, tonicity-responsive
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000437810    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006599.2-2352s21c1
Sequence:CCGGGTGGACTGCGTAGGGATATTGCTCGAGCAATATCCCTACGCAGTCCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006599.2-4698s1c1
Sequence:CCGGCCGAACTCAATTTCTCCACTTCTCGAGAAGTGGAGAAATTGAGTTCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006599.2-3470s1c1
Sequence:CCGGGCAGCAGATTTCATCAAATATCTCGAGATATTTGATGAAATCTGCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020023    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006599.2-1933s1c1
Sequence:CCGGCGGACAACAAAGGCAACTCAACTCGAGTTGAGTTGCCTTTGTTGTCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006599.2-3933s1c1
Sequence:CCGGGCCCAGATTCAGTCAGAGTTACTCGAGTAACTCTGACTGAATCTGGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018823
VALIDATED
NFAT5 MISSION shRNA Bacterial Glycerol Stock
nuclear factor of activated T-cells 5, tonicity-responsive
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000229557    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_018823.2-1218s21c1
Sequence:CCGGTGCGGACAGTATCCGGTTAAACTCGAGTTTAACCGGATACTGTCCGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229559    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_018823.2-1451s21c1
Sequence:CCGGTAGAGTAACTGGGCGAAATACCTCGAGGTATTTCGCCCAGTTACTCTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218916    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_018823.2-8033s21c1
Sequence:GTACCGGACCATATTCCTGCTCGAATATCTCGAGATATTCGAGCAGGAATATGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085647    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_018823.1-2972s1c1
Sequence:CCGGCCACCATGTTTCAGACACCAACTCGAGTTGGTGTCTGAAACATGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229558    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018823.2-1406s21c1
Sequence:CCGGCAATGATTCTGGTCGAGTAAACTCGAGTTTACTCGACCAGAATCATTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229560    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_018823.2-1937s21c1
Sequence:CCGGTCCGTATCATGACCAACATATCTCGAGATATGTTGGTCATGATACGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085644    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_018823.1-1040s1c1
Sequence:CCGGGCAATGATTCTGGTCGAGTAACTCGAGTTACTCGACCAGAATCATTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085643    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018823.1-3448s1c1
Sequence:CCGGCCCAACATATTTCTTTCCCAACTCGAGTTGGGAAAGAAATATGTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018823.1-4257s1c1
Sequence:CCGGGCAGAACAACATCCCTGGAATCTCGAGATTCCAGGGATGTTGTTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085645    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018823.1-1098s1c1
Sequence:CCGGGCGAAATACAACTCCCTGCAACTCGAGTTGCAGGGAGTTGTATTTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018823
VALIDATED
NFAT5 MISSION shRNA shRNA Plasmid DNA
nuclear factor of activated T-cells 5, tonicity-responsive
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000229557    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_018823.2-1218s21c1
Sequence:CCGGTGCGGACAGTATCCGGTTAAACTCGAGTTTAACCGGATACTGTCCGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000229559    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_018823.2-1451s21c1
Sequence:CCGGTAGAGTAACTGGGCGAAATACCTCGAGGTATTTCGCCCAGTTACTCTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218916    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_018823.2-8033s21c1
Sequence:GTACCGGACCATATTCCTGCTCGAATATCTCGAGATATTCGAGCAGGAATATGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085647    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_018823.1-2972s1c1
Sequence:CCGGCCACCATGTTTCAGACACCAACTCGAGTTGGTGTCTGAAACATGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000229558    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018823.2-1406s21c1
Sequence:CCGGCAATGATTCTGGTCGAGTAAACTCGAGTTTACTCGACCAGAATCATTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000229560    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_018823.2-1937s21c1
Sequence:CCGGTCCGTATCATGACCAACATATCTCGAGATATGTTGGTCATGATACGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085644    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_018823.1-1040s1c1
Sequence:CCGGGCAATGATTCTGGTCGAGTAACTCGAGTTACTCGACCAGAATCATTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085643    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018823.1-3448s1c1
Sequence:CCGGCCCAACATATTTCTTTCCCAACTCGAGTTGGGAAAGAAATATGTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018823.1-4257s1c1
Sequence:CCGGGCAGAACAACATCCCTGGAATCTCGAGATTCCAGGGATGTTGTTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085645    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018823.1-1098s1c1
Sequence:CCGGGCGAAATACAACTCCCTGCAACTCGAGTTGCAGGGAGTTGTATTTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018823
VALIDATED
NFAT5 MISSION shRNA Lentiviral Transduction Particles
nuclear factor of activated T-cells 5, tonicity-responsive
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000229557    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_018823.2-1218s21c1
Sequence:CCGGTGCGGACAGTATCCGGTTAAACTCGAGTTTAACCGGATACTGTCCGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229559    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_018823.2-1451s21c1
Sequence:CCGGTAGAGTAACTGGGCGAAATACCTCGAGGTATTTCGCCCAGTTACTCTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218916    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_018823.2-8033s21c1
Sequence:GTACCGGACCATATTCCTGCTCGAATATCTCGAGATATTCGAGCAGGAATATGGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085647    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_018823.1-2972s1c1
Sequence:CCGGCCACCATGTTTCAGACACCAACTCGAGTTGGTGTCTGAAACATGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229558    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018823.2-1406s21c1
Sequence:CCGGCAATGATTCTGGTCGAGTAAACTCGAGTTTACTCGACCAGAATCATTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229560    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_018823.2-1937s21c1
Sequence:CCGGTCCGTATCATGACCAACATATCTCGAGATATGTTGGTCATGATACGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085644    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_018823.1-1040s1c1
Sequence:CCGGGCAATGATTCTGGTCGAGTAACTCGAGTTACTCGACCAGAATCATTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085643    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018823.1-3448s1c1
Sequence:CCGGCCCAACATATTTCTTTCCCAACTCGAGTTGGGAAAGAAATATGTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018823.1-4257s1c1
Sequence:CCGGGCAGAACAACATCCCTGGAATCTCGAGATTCCAGGGATGTTGTTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085645    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018823.1-1098s1c1
Sequence:CCGGGCGAAATACAACTCCCTGCAACTCGAGTTGCAGGGAGTTGTATTTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)