EMAIL THIS PAGE TO A FRIEND

NFATC1

nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 1

155 Gene Product Result for
Synonyms: NF-ATC NFAT2 NFATc
UniProtKB ID: O95644, Q12865, Q15793
Gene ID:
Human(4772) Summary: The product of this gene is a component of the nuclear factor of activated T cells DNA-binding transcription complex. This complex consists of at least two components: a preexisting cytosolic component that translocates to the nucleus upon T cell receptor (TCR) stimulation, and an inducible nuclear component. Proteins belonging to this family of transcription factors play a central role in inducible gene transcription during immune response. The product of this gene is an inducible nuclear component. It functions as a major molecular target for the immunosuppressive drugs such as cyclosporin A. Multiple alternatively spliced transcript variants encoding distinct isoforms have been identified for this gene. Different isoforms of this protein may regulate inducible expression of different cytokine genes. [provided by RefSeq, Jul 2013]
Mouse(18018) nuclear factor of activated T cells, cytoplasmic, calcineurin dependent 1
Rat(100361818) nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 1
Domestic Rabbit(100352378) nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 1
naked mole-rat(101697946) nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 1
domestic guinea pig(100730044) nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 1
sheep(101108097) nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 1
Zebrafish(568315) nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 1
cow(511224) nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 1
Horse(100065378) nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 1
domestic cat(101101259) nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 1
dog(483925) nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 1
chicken(420815) nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Antagonist

Product # Description Species Add to Cart
 
547905 2,2′:5′,2′′:5′′,2′′′-Quaterthiophene 96% human, mouse, rat pricing

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
N7032 NFAT Inhibitor >96% (HPLC), solid human, mouse pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006162 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006162 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006162 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_016791 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_016791 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_016791 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006162 Rosetta Predictions human pricing
NM_172387 Rosetta Predictions human pricing
NM_172388 Rosetta Predictions human pricing
NM_172389 Rosetta Predictions human pricing
NM_172390 Rosetta Predictions human pricing
NM_016791 Rosetta Predictions mouse pricing
NM_198429 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006162 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00341013 predicted 2061
2 SASI_Hs01_00210593 predicted 2031
3 SASI_Hs01_00210595 predicted 2077
4 SASI_Hs01_00210596 predicted 2067
5 SASI_Hs01_00210597 predicted 2045
6 SASI_Hs01_00210598 predicted 2070
7 SASI_Hs01_00210599 predicted 2074
8 SASI_Hs01_00210600 predicted 2035
9 SASI_Hs01_00210601 predicted 1932
10 SASI_Hs01_00210602 predicted 2040
11 SASI_Hs01_00210594 predicted 2294
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172387 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00368032 predicted 1643
2 SASI_Hs01_00116775 predicted 1607
3 SASI_Hs01_00116777 predicted 1651
4 SASI_Hs01_00116778 predicted 1634
5 SASI_Hs01_00116779 predicted 1623
6 SASI_Hs01_00116780 predicted 1649
7 SASI_Hs01_00116781 predicted 1648
8 SASI_Hs01_00116782 predicted 1611
9 SASI_Hs01_00116783 predicted 1512
10 SASI_Hs01_00116784 predicted 1617
11 SASI_Hs01_00116776 predicted 1874
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172388 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00368033 predicted 965
2 SASI_Hs01_00167386 predicted 935
3 SASI_Hs01_00167388 predicted 981
4 SASI_Hs01_00167389 predicted 968
5 SASI_Hs01_00167390 predicted 952
6 SASI_Hs01_00167391 predicted 978
7 SASI_Hs01_00167392 predicted 977
8 SASI_Hs01_00167393 predicted 938
9 SASI_Hs01_00167394 predicted 834
10 SASI_Hs01_00167395 predicted 942
11 SASI_Hs01_00167387 predicted 1202
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172389 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00368034 predicted 1640
2 SASI_Hs01_00141832 predicted 1607
3 SASI_Hs01_00141834 predicted 1651
4 SASI_Hs01_00141835 predicted 1638
5 SASI_Hs01_00141836 predicted 1621
6 SASI_Hs01_00141837 predicted 1646
7 SASI_Hs01_00141838 predicted 1644
8 SASI_Hs01_00141839 predicted 1611
9 SASI_Hs01_00141840 predicted 1508
10 SASI_Hs01_00141841 predicted 1619
11 SASI_Hs01_00141833 predicted 1871
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172390 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00368035 predicted 2067
2 SASI_Hs01_00220852 predicted 2036
3 SASI_Hs02_00368036 predicted 2074
4 SASI_Hs01_00220854 predicted 2058
5 SASI_Hs01_00220855 predicted 2049
6 SASI_Hs01_00220856 predicted 2072
7 SASI_Hs01_00220857 predicted 2072
8 SASI_Hs01_00220858 predicted 2037
9 SASI_Hs01_00220859 predicted 1933
10 SASI_Hs01_00220860 predicted 2038
11 SASI_Hs01_00220853 predicted 2293
12 SASI_Hs01_00220861 predicted 2290
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016791 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00323571 predicted 1385
2 SASI_Mm01_00029470 predicted 1006
3 SASI_Mm01_00029471 predicted 1839
4 SASI_Mm01_00029472 predicted 1376
5 SASI_Mm01_00029473 predicted 872
6 SASI_Mm01_00029474 predicted 402
7 SASI_Mm01_00029476 predicted 1578
8 SASI_Mm01_00029477 predicted 905
9 SASI_Mm01_00029478 predicted 1808
10 SASI_Mm01_00029479 predicted 339
11 SASI_Mm01_00029475 predicted 1598
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198429 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00350991 predicted 1705
2 SASI_Mm01_00129652 predicted 1326
3 SASI_Mm01_00129653 predicted 2151
4 SASI_Mm01_00129654 predicted 1689
5 SASI_Mm01_00129655 predicted 1194
6 SASI_Mm01_00129656 predicted 718
7 SASI_Mm01_00129658 predicted 1907
8 SASI_Mm01_00129659 predicted 1228
9 SASI_Mm01_00129660 predicted 2130
10 SASI_Mm01_00129661 predicted 660
11 SASI_Mm01_00129657 predicted 1915
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006162
NFATC1 MISSION shRNA Bacterial Glycerol Stock
nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000424832    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006162.3-1555s21c1
Sequence:CCGGCCCGAAGACTACTCCTCTTTCCTCGAGGAAAGAGGAGTAGTCTTCGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417132    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006162.3-3321s21c1
Sequence:CCGGATACTGGAAGTGCCTTATTTACTCGAGTAAATAAGGCACTTCCAGTATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422015    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006162.3-3378s21c1
Sequence:CCGGATTTGCTACTGTAGGAGTATTCTCGAGAATACTCCTACAGTAGCAAATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017333    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006162.3-4015s1c1
Sequence:CCGGCGGCAACATTAGAAAGTGATTCTCGAGAATCACTTTCTAATGTTGCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006162.3-2536s1c1
Sequence:CCGGCCCGCCAACGTTCCAATTATACTCGAGTATAATTGGAACGTTGGCGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017335    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006162.3-2472s1c1
Sequence:CCGGCGTCAGTTTCTACGTCTGCAACTCGAGTTGCAGACGTAGAAACTGACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006162.3-2055s1c1
Sequence:CCGGCGGAATCCTGAAACTCAGAAACTCGAGTTTCTGAGTTTCAGGATTCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006162.3-810s1c1
Sequence:CCGGCATCGAGATAACCTCGTGCTTCTCGAGAAGCACGAGGTTATCTCGATGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006162
NFATC1 MISSION shRNA shRNA Plasmid DNA
nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000424832    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006162.3-1555s21c1
Sequence:CCGGCCCGAAGACTACTCCTCTTTCCTCGAGGAAAGAGGAGTAGTCTTCGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417132    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006162.3-3321s21c1
Sequence:CCGGATACTGGAAGTGCCTTATTTACTCGAGTAAATAAGGCACTTCCAGTATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422015    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006162.3-3378s21c1
Sequence:CCGGATTTGCTACTGTAGGAGTATTCTCGAGAATACTCCTACAGTAGCAAATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017333    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006162.3-4015s1c1
Sequence:CCGGCGGCAACATTAGAAAGTGATTCTCGAGAATCACTTTCTAATGTTGCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006162.3-2536s1c1
Sequence:CCGGCCCGCCAACGTTCCAATTATACTCGAGTATAATTGGAACGTTGGCGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017335    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006162.3-2472s1c1
Sequence:CCGGCGTCAGTTTCTACGTCTGCAACTCGAGTTGCAGACGTAGAAACTGACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006162.3-2055s1c1
Sequence:CCGGCGGAATCCTGAAACTCAGAAACTCGAGTTTCTGAGTTTCAGGATTCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006162.3-810s1c1
Sequence:CCGGCATCGAGATAACCTCGTGCTTCTCGAGAAGCACGAGGTTATCTCGATGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006162
NFATC1 MISSION shRNA Lentiviral Transduction Particles
nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000424832    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006162.3-1555s21c1
Sequence:CCGGCCCGAAGACTACTCCTCTTTCCTCGAGGAAAGAGGAGTAGTCTTCGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417132    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006162.3-3321s21c1
Sequence:CCGGATACTGGAAGTGCCTTATTTACTCGAGTAAATAAGGCACTTCCAGTATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422015    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006162.3-3378s21c1
Sequence:CCGGATTTGCTACTGTAGGAGTATTCTCGAGAATACTCCTACAGTAGCAAATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017333    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006162.3-4015s1c1
Sequence:CCGGCGGCAACATTAGAAAGTGATTCTCGAGAATCACTTTCTAATGTTGCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006162.3-2536s1c1
Sequence:CCGGCCCGCCAACGTTCCAATTATACTCGAGTATAATTGGAACGTTGGCGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017335    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006162.3-2472s1c1
Sequence:CCGGCGTCAGTTTCTACGTCTGCAACTCGAGTTGCAGACGTAGAAACTGACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006162.3-2055s1c1
Sequence:CCGGCGGAATCCTGAAACTCAGAAACTCGAGTTTCTGAGTTTCAGGATTCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006162.3-810s1c1
Sequence:CCGGCATCGAGATAACCTCGTGCTTCTCGAGAAGCACGAGGTTATCTCGATGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016791
VALIDATED
NFATC1 MISSION shRNA Bacterial Glycerol Stock
nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 1
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000349759    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016791.3-853s21c1
Sequence:CCGGGGTCAGTGTGACCGAAGATACCTCGAGGTATCTTCGGTCACACTGACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348073    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016791.4-2112s21c1
Sequence:CCGGACTCTGTCTTTCTAACCTTAACTCGAGTTAAGGTTAGAAAGACAGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000347997    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016791.4-1627s21c1
Sequence:CCGGGAAGCTCAGAAACTCTGATATCTCGAGATATCAGAGTTTCTGAGCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312781    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016791.3-880s21c1
Sequence:CCGGCGGTAACACCACCCAGTATACCTCGAGGTATACTGGGTGGTGTTACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311848    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016791.3-1985s21c1
Sequence:CCGGCCCGTCCAAGTCAGTTTCTATCTCGAGATAGAAACTGACTTGGACGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312782    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016791.3-2390s21c1
Sequence:CCGGTCTAACCTCTGTGAGTCTTTGCTCGAGCAAAGACTCACAGAGGTTAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312831    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016791.3-317s21c1
Sequence:CCGGACTCTGGAGAGTCCGAGAATCCTCGAGGATTCTCGGACTCTCCAGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000347998    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016791.4-2243s21c1
Sequence:CCGGACACCACGTGATAGCCCTATTCTCGAGAATAGGGCTATCACGTGGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081923    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016791.2-2134s1c1
Sequence:CCGGCCGAGGCTATAAGAGGATGTTCTCGAGAACATCCTCTTATAGCCTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081925    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016791.2-1985s1c1
Sequence:CCGGCCCGTCCAAGTCAGTTTCTATCTCGAGATAGAAACTGACTTGGACGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016791.2-1185s1c1
Sequence:CCGGCGACATCATATATGAGCCCATCTCGAGATGGGCTCATATATGATGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016791.2-1361s1c1
Sequence:CCGGCTACACGGTTACTTGGAGAATCTCGAGATTCTCCAAGTAACCGTGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016791.2-92s1c1
Sequence:CCGGGCCGCAGAACACTACAGTTATCTCGAGATAACTGTAGTGTTCTGCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016791
VALIDATED
NFATC1 MISSION shRNA shRNA Plasmid DNA
nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 1
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000349759    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016791.3-853s21c1
Sequence:CCGGGGTCAGTGTGACCGAAGATACCTCGAGGTATCTTCGGTCACACTGACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000348073    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016791.4-2112s21c1
Sequence:CCGGACTCTGTCTTTCTAACCTTAACTCGAGTTAAGGTTAGAAAGACAGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000347997    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016791.4-1627s21c1
Sequence:CCGGGAAGCTCAGAAACTCTGATATCTCGAGATATCAGAGTTTCTGAGCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312781    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016791.3-880s21c1
Sequence:CCGGCGGTAACACCACCCAGTATACCTCGAGGTATACTGGGTGGTGTTACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000311848    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016791.3-1985s21c1
Sequence:CCGGCCCGTCCAAGTCAGTTTCTATCTCGAGATAGAAACTGACTTGGACGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312782    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016791.3-2390s21c1
Sequence:CCGGTCTAACCTCTGTGAGTCTTTGCTCGAGCAAAGACTCACAGAGGTTAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312831    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016791.3-317s21c1
Sequence:CCGGACTCTGGAGAGTCCGAGAATCCTCGAGGATTCTCGGACTCTCCAGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000347998    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016791.4-2243s21c1
Sequence:CCGGACACCACGTGATAGCCCTATTCTCGAGAATAGGGCTATCACGTGGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081923    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016791.2-2134s1c1
Sequence:CCGGCCGAGGCTATAAGAGGATGTTCTCGAGAACATCCTCTTATAGCCTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081925    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016791.2-1985s1c1
Sequence:CCGGCCCGTCCAAGTCAGTTTCTATCTCGAGATAGAAACTGACTTGGACGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016791.2-1185s1c1
Sequence:CCGGCGACATCATATATGAGCCCATCTCGAGATGGGCTCATATATGATGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016791.2-1361s1c1
Sequence:CCGGCTACACGGTTACTTGGAGAATCTCGAGATTCTCCAAGTAACCGTGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016791.2-92s1c1
Sequence:CCGGGCCGCAGAACACTACAGTTATCTCGAGATAACTGTAGTGTTCTGCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016791
VALIDATED
NFATC1 MISSION shRNA Lentiviral Transduction Particles
nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 1
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000349759    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016791.3-853s21c1
Sequence:CCGGGGTCAGTGTGACCGAAGATACCTCGAGGTATCTTCGGTCACACTGACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348073    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016791.4-2112s21c1
Sequence:CCGGACTCTGTCTTTCTAACCTTAACTCGAGTTAAGGTTAGAAAGACAGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000347997    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016791.4-1627s21c1
Sequence:CCGGGAAGCTCAGAAACTCTGATATCTCGAGATATCAGAGTTTCTGAGCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312781    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016791.3-880s21c1
Sequence:CCGGCGGTAACACCACCCAGTATACCTCGAGGTATACTGGGTGGTGTTACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311848    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016791.3-1985s21c1
Sequence:CCGGCCCGTCCAAGTCAGTTTCTATCTCGAGATAGAAACTGACTTGGACGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312782    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016791.3-2390s21c1
Sequence:CCGGTCTAACCTCTGTGAGTCTTTGCTCGAGCAAAGACTCACAGAGGTTAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312831    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016791.3-317s21c1
Sequence:CCGGACTCTGGAGAGTCCGAGAATCCTCGAGGATTCTCGGACTCTCCAGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000347998    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016791.4-2243s21c1
Sequence:CCGGACACCACGTGATAGCCCTATTCTCGAGAATAGGGCTATCACGTGGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081923    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016791.2-2134s1c1
Sequence:CCGGCCGAGGCTATAAGAGGATGTTCTCGAGAACATCCTCTTATAGCCTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081925    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016791.2-1985s1c1
Sequence:CCGGCCCGTCCAAGTCAGTTTCTATCTCGAGATAGAAACTGACTTGGACGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016791.2-1185s1c1
Sequence:CCGGCGACATCATATATGAGCCCATCTCGAGATGGGCTCATATATGATGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016791.2-1361s1c1
Sequence:CCGGCTACACGGTTACTTGGAGAATCTCGAGATTCTCCAAGTAACCGTGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016791.2-92s1c1
Sequence:CCGGGCCGCAGAACACTACAGTTATCTCGAGATAACTGTAGTGTTCTGCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)