EMAIL THIS PAGE TO A FRIEND

NFATC2IP

nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 2 interacting protein

52 Gene Product Result for
Synonyms: ESC2 NIP45 RAD60
UniProtKB ID: Q8NCF5, B7Z4G5, Q66K34, Q6NVK1, Q8NFR2, Q96ST9
Gene ID:
Mouse(18020) nuclear factor of activated T cells, cytoplasmic, calcineurin dependent 2 interacting protein
Rat(308983) nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 2 interacting protein
naked mole-rat(101714317) nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 2 interacting protein
domestic guinea pig(100724058) nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 2 interacting protein
sheep(101121231) nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 2 interacting protein
Zebrafish(337574) nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 2 interacting protein
cow(505998) nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 2 interacting protein
domestic cat(101094560) nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 2 interacting protein
dog(607936) nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 2 interacting protein
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032815 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032815 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032815 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010900 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010900 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010900 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032815 Rosetta Predictions human pricing
NM_001007692 Rosetta Predictions rat pricing
NM_010900 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032815 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00051088 predicted 1721
2 SASI_Hs01_00051090 predicted 487
3 SASI_Hs01_00051091 predicted 1608
4 SASI_Hs01_00051092 predicted 1350
5 SASI_Hs01_00051093 predicted 999
6 SASI_Hs01_00051094 predicted 418
7 SASI_Hs01_00051095 predicted 653
8 SASI_Hs01_00051096 predicted 1733
9 SASI_Hs01_00051097 predicted 1415
10 SASI_Hs02_00360395 predicted 943
11 SASI_Hs01_00051089 predicted 1426
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007692 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00083372 predicted 347
2 SASI_Rn02_00198845 predicted 233
3 SASI_Rn02_00198846 predicted 1177
4 SASI_Rn01_00083373 predicted 281
5 SASI_Rn01_00083374 predicted 882
6 SASI_Rn01_00083375 predicted 966
7 SASI_Rn01_00083376 predicted 1089
8 SASI_Rn01_00083377 predicted 876
9 SASI_Rn01_00083378 predicted 1203
10 SASI_Rn01_00083379 predicted 928
11 SASI_Rn01_00083371 predicted 1197
12 SASI_Rn01_00083380 predicted 1095
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010900 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00184495 predicted 1526
2 SASI_Mm01_00184496 predicted 1637
3 SASI_Mm01_00184497 predicted 1424
4 SASI_Mm01_00184498 predicted 1350
5 SASI_Mm01_00184499 predicted 1469
6 SASI_Mm01_00184500 predicted 1458
7 SASI_Mm01_00184501 predicted 1095
8 SASI_Mm01_00184504 predicted 1341
9 SASI_Mm02_00319618 predicted 987
10 SASI_Mm02_00319619 predicted 1411
11 SASI_Mm01_00184502 predicted 1517
12 SASI_Mm01_00184503 predicted 1740
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032815
NFATC2IP MISSION shRNA Bacterial Glycerol Stock
nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 2 interacting protein
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435445    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032815.3-420s21c1
Sequence:CCGGCCTTATCCCAGATGATCTATCCTCGAGGATAGATCATCTGGGATAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416062    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032815.3-1130s21c1
Sequence:CCGGAGACCCTCATGTCCCACTATGCTCGAGCATAGTGGGACATGAGGGTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432363    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032815.3-1724s21c1
Sequence:CCGGACATTTGCTTGAGGCTTATACCTCGAGGTATAAGCCTCAAGCAAATGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073134    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_032815.2-560s1c1
Sequence:CCGGCTGAGGACTAAGGATAAAGAACTCGAGTTCTTTATCCTTAGTCCTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073135    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_032815.2-673s1c1
Sequence:CCGGCAAGAAGTTAAGTGAGGTGAACTCGAGTTCACCTCACTTAACTTCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073137    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_032815.2-277s1c1
Sequence:CCGGCCGGGATAACAGCAACAGTGACTCGAGTCACTGTTGCTGTTATCCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073136    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_032815.2-951s1c1
Sequence:CCGGGAGAGACAGAGCTATCACCTACTCGAGTAGGTGATAGCTCTGTCTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032815
NFATC2IP MISSION shRNA shRNA Plasmid DNA
nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 2 interacting protein
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435445    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032815.3-420s21c1
Sequence:CCGGCCTTATCCCAGATGATCTATCCTCGAGGATAGATCATCTGGGATAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416062    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032815.3-1130s21c1
Sequence:CCGGAGACCCTCATGTCCCACTATGCTCGAGCATAGTGGGACATGAGGGTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432363    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032815.3-1724s21c1
Sequence:CCGGACATTTGCTTGAGGCTTATACCTCGAGGTATAAGCCTCAAGCAAATGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000073134    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_032815.2-560s1c1
Sequence:CCGGCTGAGGACTAAGGATAAAGAACTCGAGTTCTTTATCCTTAGTCCTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000073135    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_032815.2-673s1c1
Sequence:CCGGCAAGAAGTTAAGTGAGGTGAACTCGAGTTCACCTCACTTAACTTCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000073137    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_032815.2-277s1c1
Sequence:CCGGCCGGGATAACAGCAACAGTGACTCGAGTCACTGTTGCTGTTATCCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000073136    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_032815.2-951s1c1
Sequence:CCGGGAGAGACAGAGCTATCACCTACTCGAGTAGGTGATAGCTCTGTCTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032815
NFATC2IP MISSION shRNA Lentiviral Transduction Particles
nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 2 interacting protein
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435445    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032815.3-420s21c1
Sequence:CCGGCCTTATCCCAGATGATCTATCCTCGAGGATAGATCATCTGGGATAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416062    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032815.3-1130s21c1
Sequence:CCGGAGACCCTCATGTCCCACTATGCTCGAGCATAGTGGGACATGAGGGTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432363    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032815.3-1724s21c1
Sequence:CCGGACATTTGCTTGAGGCTTATACCTCGAGGTATAAGCCTCAAGCAAATGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073134    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_032815.2-560s1c1
Sequence:CCGGCTGAGGACTAAGGATAAAGAACTCGAGTTCTTTATCCTTAGTCCTCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073135    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_032815.2-673s1c1
Sequence:CCGGCAAGAAGTTAAGTGAGGTGAACTCGAGTTCACCTCACTTAACTTCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073137    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_032815.2-277s1c1
Sequence:CCGGCCGGGATAACAGCAACAGTGACTCGAGTCACTGTTGCTGTTATCCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073136    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_032815.2-951s1c1
Sequence:CCGGGAGAGACAGAGCTATCACCTACTCGAGTAGGTGATAGCTCTGTCTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010900
VALIDATED
NFATC2IP MISSION shRNA Bacterial Glycerol Stock
nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 2 interacting protein
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000305163    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010900.2-452s21c1
Sequence:CCGGGATGAGGCAGATCTGACAAATCTCGAGATTTGTCAGATCTGCCTCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305162    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010900.2-972s21c1
Sequence:CCGGTTGGAGTGGCTGACATCATTGCTCGAGCAATGATGTCAGCCACTCCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305161    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010900.2-1116s21c1
Sequence:CCGGAGGTTCTCATGTCACACTATGCTCGAGCATAGTGTGACATGAGAACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308909    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010900.2-2418s21c1
Sequence:CCGGGCGCTGTTGAAATCCTGATTTCTCGAGAAATCAGGATTTCAACAGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308973    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010900.2-896s21c1
Sequence:CCGGGTGTCTCCAAACAGGATTCTTCTCGAGAAGAATCCTGTTTGGAGACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099150    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010900.1-2420s1c1
Sequence:CCGGGCGCTGTTGAAATCCTGATTTCTCGAGAAATCAGGATTTCAACAGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099151    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010900.1-396s1c1
Sequence:CCGGCCTCAACCTCATTCCAGATAACTCGAGTTATCTGGAATGAGGTTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099153    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010900.1-898s1c1
Sequence:CCGGGTGTCTCCAAACAGGATTCTTCTCGAGAAGAATCCTGTTTGGAGACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099154    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010900.1-664s1c1
Sequence:CCGGGAAGTGAACAAGCGTCTCCAACTCGAGTTGGAGACGCTTGTTCACTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099152    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010900.1-398s1c1
Sequence:CCGGTCAACCTCATTCCAGATAATTCTCGAGAATTATCTGGAATGAGGTTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010900
VALIDATED
NFATC2IP MISSION shRNA shRNA Plasmid DNA
nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 2 interacting protein
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000305163    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010900.2-452s21c1
Sequence:CCGGGATGAGGCAGATCTGACAAATCTCGAGATTTGTCAGATCTGCCTCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305162    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010900.2-972s21c1
Sequence:CCGGTTGGAGTGGCTGACATCATTGCTCGAGCAATGATGTCAGCCACTCCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305161    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010900.2-1116s21c1
Sequence:CCGGAGGTTCTCATGTCACACTATGCTCGAGCATAGTGTGACATGAGAACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000308909    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010900.2-2418s21c1
Sequence:CCGGGCGCTGTTGAAATCCTGATTTCTCGAGAAATCAGGATTTCAACAGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000308973    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010900.2-896s21c1
Sequence:CCGGGTGTCTCCAAACAGGATTCTTCTCGAGAAGAATCCTGTTTGGAGACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099150    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010900.1-2420s1c1
Sequence:CCGGGCGCTGTTGAAATCCTGATTTCTCGAGAAATCAGGATTTCAACAGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099151    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010900.1-396s1c1
Sequence:CCGGCCTCAACCTCATTCCAGATAACTCGAGTTATCTGGAATGAGGTTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099153    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010900.1-898s1c1
Sequence:CCGGGTGTCTCCAAACAGGATTCTTCTCGAGAAGAATCCTGTTTGGAGACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099154    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010900.1-664s1c1
Sequence:CCGGGAAGTGAACAAGCGTCTCCAACTCGAGTTGGAGACGCTTGTTCACTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099152    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010900.1-398s1c1
Sequence:CCGGTCAACCTCATTCCAGATAATTCTCGAGAATTATCTGGAATGAGGTTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010900
VALIDATED
NFATC2IP MISSION shRNA Lentiviral Transduction Particles
nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 2 interacting protein
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000305163    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010900.2-452s21c1
Sequence:CCGGGATGAGGCAGATCTGACAAATCTCGAGATTTGTCAGATCTGCCTCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305162    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010900.2-972s21c1
Sequence:CCGGTTGGAGTGGCTGACATCATTGCTCGAGCAATGATGTCAGCCACTCCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305161    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010900.2-1116s21c1
Sequence:CCGGAGGTTCTCATGTCACACTATGCTCGAGCATAGTGTGACATGAGAACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308909    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010900.2-2418s21c1
Sequence:CCGGGCGCTGTTGAAATCCTGATTTCTCGAGAAATCAGGATTTCAACAGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308973    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010900.2-896s21c1
Sequence:CCGGGTGTCTCCAAACAGGATTCTTCTCGAGAAGAATCCTGTTTGGAGACACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099150    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010900.1-2420s1c1
Sequence:CCGGGCGCTGTTGAAATCCTGATTTCTCGAGAAATCAGGATTTCAACAGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099151    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010900.1-396s1c1
Sequence:CCGGCCTCAACCTCATTCCAGATAACTCGAGTTATCTGGAATGAGGTTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099153    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010900.1-898s1c1
Sequence:CCGGGTGTCTCCAAACAGGATTCTTCTCGAGAAGAATCCTGTTTGGAGACACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099154    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010900.1-664s1c1
Sequence:CCGGGAAGTGAACAAGCGTCTCCAACTCGAGTTGGAGACGCTTGTTCACTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099152    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010900.1-398s1c1
Sequence:CCGGTCAACCTCATTCCAGATAATTCTCGAGAATTATCTGGAATGAGGTTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)