EMAIL THIS PAGE TO A FRIEND

NFATC3

nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 3

148 Gene Product Result for
Synonyms: NFAT4 NFATX
UniProtKB ID: Q12968, O75211, Q14516, Q99840, Q99841, Q99842
Gene ID:
Human(4775) Summary: The product of this gene is a member of the nuclear factors of activated T cells DNA-binding transcription complex. This complex consists of at least two components: a preexisting cytosolic component that translocates to the nucleus upon T cell receptor (TCR) stimulation and an inducible nuclear component. Other members of this family participate to form this complex also. The product of this gene plays a role in the regulation of gene expression in T cells and immature thymocytes. Several transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Nov 2010]
Mouse(18021) nuclear factor of activated T cells, cytoplasmic, calcineurin dependent 3
Rat(361400) nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 3
Zebrafish(561772) nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 3
cow(541127) nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 3
chicken(415711) nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 3
dog(479678) nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 3
sheep(101117607) nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 3
domestic guinea pig(100728433) nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 3
naked mole-rat(101696341) nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004555 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004555 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004555 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010901 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010901 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010901 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004555 Rosetta Predictions human pricing
NM_173163 Rosetta Predictions human pricing
NM_173164 Rosetta Predictions human pricing
NM_173165 Rosetta Predictions human pricing
NM_001108447 Rosetta Predictions rat pricing
NM_010901 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004555 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00243957 predicted 2783
2 SASI_Hs01_00243958 predicted 1808
3 SASI_Hs01_00243960 predicted 2622
4 SASI_Hs01_00243961 predicted 2934
5 SASI_Hs01_00243962 predicted 2187
6 SASI_Hs01_00243963 predicted 2712
7 SASI_Hs01_00243964 predicted 1367
8 SASI_Hs01_00243965 predicted 885
9 SASI_Hs01_00243966 predicted 1356
10 SASI_Hs02_00337878 predicted 749
11 SASI_Hs01_00243959 predicted 2401
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173163 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00193178 predicted 2789
2 SASI_Hs01_00193179 predicted 1809
3 SASI_Hs01_00193181 predicted 2616
4 SASI_Hs01_00193182 predicted 2939
5 SASI_Hs01_00193183 predicted 2190
6 SASI_Hs01_00193184 predicted 2710
7 SASI_Hs01_00193185 predicted 1366
8 SASI_Hs01_00193186 predicted 887
9 SASI_Hs01_00193187 predicted 1363
10 SASI_Hs02_00368133 predicted 745
11 SASI_Hs01_00193180 predicted 2401
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173164 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00162686 predicted 2783
2 SASI_Hs01_00162687 predicted 1802
3 SASI_Hs01_00162689 predicted 2622
4 SASI_Hs01_00162690 predicted 2938
5 SASI_Hs01_00162691 predicted 2196
6 SASI_Hs01_00162692 predicted 2711
7 SASI_Hs01_00162693 predicted 1375
8 SASI_Hs01_00162694 predicted 891
9 SASI_Hs01_00162695 predicted 1364
10 SASI_Hs02_00368134 predicted 744
11 SASI_Hs01_00162688 predicted 2398
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173165 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00115425 predicted 2789
2 SASI_Hs01_00115426 predicted 1803
3 SASI_Hs01_00115428 predicted 2616
4 SASI_Hs01_00115429 predicted 2939
5 SASI_Hs01_00115430 predicted 2189
6 SASI_Hs01_00115431 predicted 2712
7 SASI_Hs01_00115432 predicted 1367
8 SASI_Hs01_00115433 predicted 891
9 SASI_Hs01_00115434 predicted 1363
10 SASI_Hs02_00368135 predicted 751
11 SASI_Hs01_00115427 predicted 2397
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108447 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00238729 predicted 3129
2 SASI_Rn02_00238730 predicted 2362
3 SASI_Rn02_00238731 predicted 1099
4 SASI_Rn02_00238732 predicted 2490
5 SASI_Rn02_00238733 predicted 3231
6 SASI_Rn02_00238734 predicted 2965
7 SASI_Rn02_00238735 predicted 359
8 SASI_Rn02_00238736 predicted 2068
9 SASI_Rn02_00238737 predicted 3040
10 SASI_Rn02_00238738 predicted 3155
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010901 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00319620 predicted 664
2 SASI_Mm01_00171794 predicted 1925
3 SASI_Mm02_00319621 predicted 394
4 SASI_Mm01_00171796 predicted 3174
5 SASI_Mm01_00171797 predicted 2688
6 SASI_Mm01_00171798 predicted 2273
7 SASI_Mm02_00319622 predicted 442
8 SASI_Mm01_00171799 predicted 2692
9 SASI_Mm01_00171800 predicted 3098
10 SASI_Mm01_00171802 predicted 2743
11 SASI_Mm01_00171795 predicted 745
12 SASI_Mm01_00171801 predicted 380
13 SASI_Mm01_00171803 predicted 2384
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004555
VALIDATED
NFATC3 MISSION shRNA Bacterial Glycerol Stock
nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 3
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000427204    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004555.2-2196s21c1
Sequence:CCGGTGAAGTTCCTCCATATCATAACTCGAGTTATGATATGGAGGAACTTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423201    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004555.2-1659s21c1
Sequence:CCGGGACAGCAGATGATCGATATTTCTCGAGAAATATCGATCATCTGCTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425821    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004555.2-1532s21c1
Sequence:CCGGCTCATCATCGAGCCCATTATGCTCGAGCATAATGGGCTCGATGATGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423793    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004555.2-800s21c1
Sequence:CCGGATGAAGCTGCAGCCCGATTTACTCGAGTAAATCGGGCTGCAGCTTCATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014532    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A3
TRC Version: 1 Clone ID:NM_004555.2-321s1c1
Sequence:CCGGGCCAGATGATTGTGCATCCATCTCGAGATGGATGCACAATCATCTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014528    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: A3
TRC Version: 1 Clone ID:NM_004555.2-3425s1c1
Sequence:CCGGCGAGATAATTGGGAGAGACATCTCGAGATGTCTCTCCCAATTATCTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014530    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A3
TRC Version: 1 Clone ID:NM_004555.2-533s1c1
Sequence:CCGGGCCCAAGTATTCAAATTACATCTCGAGATGTAATTTGAATACTTGGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004555.2-1808s1c1
Sequence:CCGGCCAGTATTGATTGTGCAGGTACTCGAGTACCTGCACAATCAATACTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014529    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A3
TRC Version: 1 Clone ID:NM_004555.2-2930s1c1
Sequence:CCGGCGTCTCAGTTACAACCTATTACTCGAGTAATAGGTTGTAACTGAGACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422320    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004555.2-1606s21c1
Sequence:CCGGGTGAAGCTCCTGGGCTATAACCTCGAGGTTATAGCCCAGGAGCTTCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004555
VALIDATED
NFATC3 MISSION shRNA shRNA Plasmid DNA
nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 3
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000427204    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004555.2-2196s21c1
Sequence:CCGGTGAAGTTCCTCCATATCATAACTCGAGTTATGATATGGAGGAACTTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423201    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004555.2-1659s21c1
Sequence:CCGGGACAGCAGATGATCGATATTTCTCGAGAAATATCGATCATCTGCTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425821    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004555.2-1532s21c1
Sequence:CCGGCTCATCATCGAGCCCATTATGCTCGAGCATAATGGGCTCGATGATGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423793    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004555.2-800s21c1
Sequence:CCGGATGAAGCTGCAGCCCGATTTACTCGAGTAAATCGGGCTGCAGCTTCATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014532    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A3
TRC Version: 1 Clone ID:NM_004555.2-321s1c1
Sequence:CCGGGCCAGATGATTGTGCATCCATCTCGAGATGGATGCACAATCATCTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014528    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: A3
TRC Version: 1 Clone ID:NM_004555.2-3425s1c1
Sequence:CCGGCGAGATAATTGGGAGAGACATCTCGAGATGTCTCTCCCAATTATCTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014530    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A3
TRC Version: 1 Clone ID:NM_004555.2-533s1c1
Sequence:CCGGGCCCAAGTATTCAAATTACATCTCGAGATGTAATTTGAATACTTGGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004555.2-1808s1c1
Sequence:CCGGCCAGTATTGATTGTGCAGGTACTCGAGTACCTGCACAATCAATACTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014529    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A3
TRC Version: 1 Clone ID:NM_004555.2-2930s1c1
Sequence:CCGGCGTCTCAGTTACAACCTATTACTCGAGTAATAGGTTGTAACTGAGACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422320    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004555.2-1606s21c1
Sequence:CCGGGTGAAGCTCCTGGGCTATAACCTCGAGGTTATAGCCCAGGAGCTTCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004555
VALIDATED
NFATC3 MISSION shRNA Lentiviral Transduction Particles
nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 3
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000427204    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004555.2-2196s21c1
Sequence:CCGGTGAAGTTCCTCCATATCATAACTCGAGTTATGATATGGAGGAACTTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423201    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004555.2-1659s21c1
Sequence:CCGGGACAGCAGATGATCGATATTTCTCGAGAAATATCGATCATCTGCTGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425821    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004555.2-1532s21c1
Sequence:CCGGCTCATCATCGAGCCCATTATGCTCGAGCATAATGGGCTCGATGATGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423793    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004555.2-800s21c1
Sequence:CCGGATGAAGCTGCAGCCCGATTTACTCGAGTAAATCGGGCTGCAGCTTCATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014532    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A3
TRC Version: 1 Clone ID:NM_004555.2-321s1c1
Sequence:CCGGGCCAGATGATTGTGCATCCATCTCGAGATGGATGCACAATCATCTGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014528    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: A3
TRC Version: 1 Clone ID:NM_004555.2-3425s1c1
Sequence:CCGGCGAGATAATTGGGAGAGACATCTCGAGATGTCTCTCCCAATTATCTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014530    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A3
TRC Version: 1 Clone ID:NM_004555.2-533s1c1
Sequence:CCGGGCCCAAGTATTCAAATTACATCTCGAGATGTAATTTGAATACTTGGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004555.2-1808s1c1
Sequence:CCGGCCAGTATTGATTGTGCAGGTACTCGAGTACCTGCACAATCAATACTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014529    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A3
TRC Version: 1 Clone ID:NM_004555.2-2930s1c1
Sequence:CCGGCGTCTCAGTTACAACCTATTACTCGAGTAATAGGTTGTAACTGAGACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422320    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004555.2-1606s21c1
Sequence:CCGGGTGAAGCTCCTGGGCTATAACCTCGAGGTTATAGCCCAGGAGCTTCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010901
VALIDATED
NFATC3 MISSION shRNA Bacterial Glycerol Stock
nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 3
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000305026    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010901.2-3388s21c1
Sequence:CCGGGATGATGTGAACGAGATTATTCTCGAGAATAATCTCGTTCACATCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308369    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010901.2-962s21c1
Sequence:CCGGCCTGGCATCAACAGTATGGATCTCGAGATCCATACTGTTGATGCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010901.2-2263s21c1
Sequence:CCGGGCTCACATTGTCCTTGAAGTTCTCGAGAACTTCAAGGACAATGTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000377122    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010901.2-2143s21c1
Sequence:CCGGATGATTGTGACTGGATCTAATCTCGAGATTAGATCCAGTCACAATCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097130    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010901.1-1979s1c1
Sequence:CCGGGCTCACATTGTCCTTGAAGTTCTCGAGAACTTCAAGGACAATGTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097129    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010901.1-3407s1c1
Sequence:CCGGGTGGGAAACGAGCTTTGCTTTCTCGAGAAAGCAAAGCTCGTTTCCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097132    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010901.1-678s1c1
Sequence:CCGGCCTGGCATCAACAGTATGGATCTCGAGATCCATACTGTTGATGCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097133    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010901.1-119s1c1
Sequence:CCGGCCAGATGATTGTGCATCCATTCTCGAGAATGGATGCACAATCATCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010901.1-2004s1c1
Sequence:CCGGCCTATCATAACCCAGCAGTTACTCGAGTAACTGCTGGGTTATGATAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308440    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010901.2-400s21c1
Sequence:CCGGCCAGATGATTGTGCATCCATTCTCGAGAATGGATGCACAATCATCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010901
VALIDATED
NFATC3 MISSION shRNA shRNA Plasmid DNA
nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 3
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000305026    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010901.2-3388s21c1
Sequence:CCGGGATGATGTGAACGAGATTATTCTCGAGAATAATCTCGTTCACATCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000308369    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010901.2-962s21c1
Sequence:CCGGCCTGGCATCAACAGTATGGATCTCGAGATCCATACTGTTGATGCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000308439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010901.2-2263s21c1
Sequence:CCGGGCTCACATTGTCCTTGAAGTTCTCGAGAACTTCAAGGACAATGTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000377122    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010901.2-2143s21c1
Sequence:CCGGATGATTGTGACTGGATCTAATCTCGAGATTAGATCCAGTCACAATCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097130    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010901.1-1979s1c1
Sequence:CCGGGCTCACATTGTCCTTGAAGTTCTCGAGAACTTCAAGGACAATGTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097129    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010901.1-3407s1c1
Sequence:CCGGGTGGGAAACGAGCTTTGCTTTCTCGAGAAAGCAAAGCTCGTTTCCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097132    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010901.1-678s1c1
Sequence:CCGGCCTGGCATCAACAGTATGGATCTCGAGATCCATACTGTTGATGCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097133    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010901.1-119s1c1
Sequence:CCGGCCAGATGATTGTGCATCCATTCTCGAGAATGGATGCACAATCATCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010901.1-2004s1c1
Sequence:CCGGCCTATCATAACCCAGCAGTTACTCGAGTAACTGCTGGGTTATGATAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000308440    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010901.2-400s21c1
Sequence:CCGGCCAGATGATTGTGCATCCATTCTCGAGAATGGATGCACAATCATCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010901
VALIDATED
NFATC3 MISSION shRNA Lentiviral Transduction Particles
nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 3
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000305026    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010901.2-3388s21c1
Sequence:CCGGGATGATGTGAACGAGATTATTCTCGAGAATAATCTCGTTCACATCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308369    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010901.2-962s21c1
Sequence:CCGGCCTGGCATCAACAGTATGGATCTCGAGATCCATACTGTTGATGCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010901.2-2263s21c1
Sequence:CCGGGCTCACATTGTCCTTGAAGTTCTCGAGAACTTCAAGGACAATGTGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000377122    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010901.2-2143s21c1
Sequence:CCGGATGATTGTGACTGGATCTAATCTCGAGATTAGATCCAGTCACAATCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097130    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010901.1-1979s1c1
Sequence:CCGGGCTCACATTGTCCTTGAAGTTCTCGAGAACTTCAAGGACAATGTGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097129    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010901.1-3407s1c1
Sequence:CCGGGTGGGAAACGAGCTTTGCTTTCTCGAGAAAGCAAAGCTCGTTTCCCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097132    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010901.1-678s1c1
Sequence:CCGGCCTGGCATCAACAGTATGGATCTCGAGATCCATACTGTTGATGCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097133    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010901.1-119s1c1
Sequence:CCGGCCAGATGATTGTGCATCCATTCTCGAGAATGGATGCACAATCATCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010901.1-2004s1c1
Sequence:CCGGCCTATCATAACCCAGCAGTTACTCGAGTAACTGCTGGGTTATGATAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308440    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010901.2-400s21c1
Sequence:CCGGCCAGATGATTGTGCATCCATTCTCGAGAATGGATGCACAATCATCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)