EMAIL THIS PAGE TO A FRIEND

NFATC4

nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 4

116 Gene Product Result for
Synonyms: NF-ATc4 NFAT3
Gene ID:
Human(4776) Summary: The product of this gene is a member of the nuclear factors of activated T cells DNA-binding transcription complex. This complex consists of at least two components: a preexisting cytosolic component that translocates to the nucleus upon T cell receptor (TCR) stimulation and an inducible nuclear component. Other members of this family of nuclear factors of activated T cells also participate in the formation of this complex. The product of this gene plays a role in the inducible expression of cytokine genes in T cells, especially in the induction of the IL-2 and IL-4. Alternatively spliced transcript variants encoding different isoforms have been noted for this gene. [provided by RefSeq, Oct 2008]
Mouse(73181) nuclear factor of activated T cells, cytoplasmic, calcineurin dependent 4
Rat(305897) nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 4
Zebrafish(561682) nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 4
Horse(100054213) nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 4
cow(788119) nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 4
domestic cat(101098235) nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 4
dog(480272) nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 4
naked mole-rat(101718532) nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 4
Domestic Rabbit(100347003) nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 4
domestic guinea pig(100734178) nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 4
sheep(101118617) nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4501983 Anti-NFAT3 antibody produced in rabbit affinity isolated antibody mouse, human
ELISA, western blot pricing
SAB4501982 Anti-NFAT3, C-Terminal antibody produced in rabbit affinity isolated antibody mouse, human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
AV32040 Anti-NFATC4 (AB1) antibody produced in rabbit affinity isolated antibody bovine, rat, human, mouse, rabbit, guinea pig, horse, canine
western blot pricing
AV38493 Anti-NFATC4 (AB2) antibody produced in rabbit affinity isolated antibody bovine, mouse, canine, guinea pig, rabbit, rat, horse, human
western blot pricing
SAB2501902 Anti-NFATC4 (C-terminal) antibody produced in goat affinity isolated antibody, buffered aqueous solution rat, pig, mouse, canine, human
ELISA, immunohistochemistry pricing
AV32715 Anti-NFATC4 antibody produced in rabbit IgG fraction of antiserum horse, human, rabbit, canine, guinea pig, mouse, bovine, rat
immunohistochemistry, western blot pricing
HPA031641 Anti-NFATC4 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
HPA076526 Anti-NFATC4 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody human
immunofluorescence pricing
SAB4504717 Anti-phospho-NFAT3 (pSer168/170) antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, immunohistochemistry pricing
SAB4503946 Anti-phospho-NFAT3 (pSer676) antibody produced in rabbit affinity isolated antibody human, rat, mouse
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_023699 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023699 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023699 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004554 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004554 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004554 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004554 Rosetta Predictions human pricing
NM_001107264 Rosetta Predictions rat pricing
NM_023699 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004554 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00138884 predicted 3315
2 SASI_Hs01_00138885 predicted 3252
3 SASI_Hs02_00337876 predicted 1677
4 SASI_Hs01_00138886 predicted 1771
5 SASI_Hs01_00138887 predicted 1655
6 SASI_Hs01_00138888 predicted 2497
7 SASI_Hs02_00337877 predicted 2905
8 SASI_Hs01_00138889 predicted 970
9 SASI_Hs01_00138891 predicted 1880
10 SASI_Hs01_00138892 predicted 2927
11 SASI_Hs01_00138890 predicted 2329
12 SASI_Hs01_00138893 predicted 1879
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107264 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00227125 predicted 1494
2 SASI_Rn02_00227126 predicted 1616
3 SASI_Rn02_00227127 predicted 2730
4 SASI_Rn02_00227128 predicted 1956
5 SASI_Rn02_00227129 predicted 1080
6 SASI_Rn02_00227130 predicted 1640
7 SASI_Rn02_00227131 predicted 1972
8 SASI_Rn02_00227132 predicted 2343
9 SASI_Rn02_00227133 predicted 1672
10 SASI_Rn02_00227134 predicted 1720
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023699 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00096367 predicted 1527
2 SASI_Mm01_00096368 predicted 1418
3 SASI_Mm01_00096369 predicted 1865
4 SASI_Mm01_00096370 predicted 1854
5 SASI_Mm01_00096371 predicted 1481
6 SASI_Mm01_00096372 predicted 1018
7 SASI_Mm01_00096373 predicted 1860
8 SASI_Mm01_00096374 predicted 1847
9 SASI_Mm01_00096375 predicted 970
10 SASI_Mm02_00327299 predicted 1584
11 SASI_Mm01_00096376 predicted 1571
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023699
VALIDATED
NFATC4 MISSION shRNA Bacterial Glycerol Stock
nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 4
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000232309    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023699.2-364s21c1
Sequence:CCGGAGTGTCCCAGCATCCGGATTACTCGAGTAATCCGGATGCTGGGACACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232313    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023699.2-2891s21c1
Sequence:CCGGTGCTGCCTTGGAAGGGACTAACTCGAGTTAGTCCCTTCCAAGGCAGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232310    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023699.2-446s21c1
Sequence:CCGGGGACGGCTCTCCTAGAGATTACTCGAGTAATCTCTAGGAGAGCCGTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232312    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023699.2-2662s21c1
Sequence:CCGGAGGAAGTGAGTGAGATCATTGCTCGAGCAATGATCTCACTCACTTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023699.2-1603s21c1
Sequence:CCGGGAATCCTGAAGCTTCGAAATTCTCGAGAATTTCGAAGCTTCAGGATTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023699.2-2217s1c1
Sequence:CCGGCCTGCTTATGAGACTCCTTATCTCGAGATAAGGAGTCTCATAAGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075340    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023699.2-1865s1c1
Sequence:CCGGGCCAGACTCTAAAGTGGTGTTCTCGAGAACACCACTTTAGAGTCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075342    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023699.2-1586s1c1
Sequence:CCGGCAACATTGACTGTGCTGGAATCTCGAGATTCCAGCACAGTCAATGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075341    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023699.2-617s1c1
Sequence:CCGGCGAGGTGGAGTCTGAACTTAACTCGAGTTAAGTTCAGACTCCACCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023699
VALIDATED
NFATC4 MISSION shRNA shRNA Plasmid DNA
nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 4
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000232309    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023699.2-364s21c1
Sequence:CCGGAGTGTCCCAGCATCCGGATTACTCGAGTAATCCGGATGCTGGGACACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232313    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023699.2-2891s21c1
Sequence:CCGGTGCTGCCTTGGAAGGGACTAACTCGAGTTAGTCCCTTCCAAGGCAGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232310    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023699.2-446s21c1
Sequence:CCGGGGACGGCTCTCCTAGAGATTACTCGAGTAATCTCTAGGAGAGCCGTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232312    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023699.2-2662s21c1
Sequence:CCGGAGGAAGTGAGTGAGATCATTGCTCGAGCAATGATCTCACTCACTTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023699.2-1603s21c1
Sequence:CCGGGAATCCTGAAGCTTCGAAATTCTCGAGAATTTCGAAGCTTCAGGATTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023699.2-2217s1c1
Sequence:CCGGCCTGCTTATGAGACTCCTTATCTCGAGATAAGGAGTCTCATAAGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075340    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023699.2-1865s1c1
Sequence:CCGGGCCAGACTCTAAAGTGGTGTTCTCGAGAACACCACTTTAGAGTCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075342    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023699.2-1586s1c1
Sequence:CCGGCAACATTGACTGTGCTGGAATCTCGAGATTCCAGCACAGTCAATGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075341    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023699.2-617s1c1
Sequence:CCGGCGAGGTGGAGTCTGAACTTAACTCGAGTTAAGTTCAGACTCCACCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023699
VALIDATED
NFATC4 MISSION shRNA Lentiviral Transduction Particles
nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 4
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000232309    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023699.2-364s21c1
Sequence:CCGGAGTGTCCCAGCATCCGGATTACTCGAGTAATCCGGATGCTGGGACACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232313    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023699.2-2891s21c1
Sequence:CCGGTGCTGCCTTGGAAGGGACTAACTCGAGTTAGTCCCTTCCAAGGCAGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232310    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023699.2-446s21c1
Sequence:CCGGGGACGGCTCTCCTAGAGATTACTCGAGTAATCTCTAGGAGAGCCGTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232312    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023699.2-2662s21c1
Sequence:CCGGAGGAAGTGAGTGAGATCATTGCTCGAGCAATGATCTCACTCACTTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023699.2-1603s21c1
Sequence:CCGGGAATCCTGAAGCTTCGAAATTCTCGAGAATTTCGAAGCTTCAGGATTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023699.2-2217s1c1
Sequence:CCGGCCTGCTTATGAGACTCCTTATCTCGAGATAAGGAGTCTCATAAGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075340    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023699.2-1865s1c1
Sequence:CCGGGCCAGACTCTAAAGTGGTGTTCTCGAGAACACCACTTTAGAGTCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075342    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023699.2-1586s1c1
Sequence:CCGGCAACATTGACTGTGCTGGAATCTCGAGATTCCAGCACAGTCAATGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075341    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023699.2-617s1c1
Sequence:CCGGCGAGGTGGAGTCTGAACTTAACTCGAGTTAAGTTCAGACTCCACCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004554
NFATC4 MISSION shRNA Bacterial Glycerol Stock
nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 4
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000232098    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004554.3-706s21c1
Sequence:CCGGGGACGGCTCTCCTAGAGATTACTCGAGTAATCTCTAGGAGAGCCGTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232102    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004554.3-4637s21c1
Sequence:CCGGAGGGCATTCGTGTCCTATTTACTCGAGTAAATAGGACACGAATGCCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232101    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004554.3-2925s21c1
Sequence:CCGGAGGAAGTGAGTGAGATCATTGCTCGAGCAATGATCTCACTCACTTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004554.3-2793s21c1
Sequence:CCGGTACCTGCTGAGGGATACAATACTCGAGTATTGTATCCCTCAGCAGGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232099    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004554.3-878s21c1
Sequence:CCGGGAGGTGGAGTCTGAGCTAAATCTCGAGATTTAGCTCAGACTCCACCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014563    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004554.3-3416s1c1
Sequence:CCGGGCCCAGAAGTTGGAAAGAGATCTCGAGATCTCTTTCCAACTTCTGGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004554.3-1877s1c1
Sequence:CCGGCGGAATTCAGACATTGAGCTTCTCGAGAAGCTCAATGTCTGAATTCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004554.3-2318s1c1
Sequence:CCGGCCTACCCAGAGTTTCAGGTTTCTCGAGAAACCTGAAACTCTGGGTAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004554.3-2481s1c1
Sequence:CCGGCTTGCGAAACTCCTTACCTATCTCGAGATAGGTAAGGAGTTTCGCAAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014564    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004554.3-319s1c1
Sequence:CCGGGCTGGAATTTAAGCTGGTGTTCTCGAGAACACCAGCTTAAATTCCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004554
NFATC4 MISSION shRNA shRNA Plasmid DNA
nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 4
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000232098    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004554.3-706s21c1
Sequence:CCGGGGACGGCTCTCCTAGAGATTACTCGAGTAATCTCTAGGAGAGCCGTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232102    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004554.3-4637s21c1
Sequence:CCGGAGGGCATTCGTGTCCTATTTACTCGAGTAAATAGGACACGAATGCCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232101    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004554.3-2925s21c1
Sequence:CCGGAGGAAGTGAGTGAGATCATTGCTCGAGCAATGATCTCACTCACTTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004554.3-2793s21c1
Sequence:CCGGTACCTGCTGAGGGATACAATACTCGAGTATTGTATCCCTCAGCAGGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232099    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004554.3-878s21c1
Sequence:CCGGGAGGTGGAGTCTGAGCTAAATCTCGAGATTTAGCTCAGACTCCACCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014563    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004554.3-3416s1c1
Sequence:CCGGGCCCAGAAGTTGGAAAGAGATCTCGAGATCTCTTTCCAACTTCTGGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004554.3-1877s1c1
Sequence:CCGGCGGAATTCAGACATTGAGCTTCTCGAGAAGCTCAATGTCTGAATTCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004554.3-2318s1c1
Sequence:CCGGCCTACCCAGAGTTTCAGGTTTCTCGAGAAACCTGAAACTCTGGGTAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004554.3-2481s1c1
Sequence:CCGGCTTGCGAAACTCCTTACCTATCTCGAGATAGGTAAGGAGTTTCGCAAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014564    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004554.3-319s1c1
Sequence:CCGGGCTGGAATTTAAGCTGGTGTTCTCGAGAACACCAGCTTAAATTCCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004554
NFATC4 MISSION shRNA Lentiviral Transduction Particles
nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 4
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000232098    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004554.3-706s21c1
Sequence:CCGGGGACGGCTCTCCTAGAGATTACTCGAGTAATCTCTAGGAGAGCCGTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232102    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004554.3-4637s21c1
Sequence:CCGGAGGGCATTCGTGTCCTATTTACTCGAGTAAATAGGACACGAATGCCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232101    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004554.3-2925s21c1
Sequence:CCGGAGGAAGTGAGTGAGATCATTGCTCGAGCAATGATCTCACTCACTTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004554.3-2793s21c1
Sequence:CCGGTACCTGCTGAGGGATACAATACTCGAGTATTGTATCCCTCAGCAGGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232099    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004554.3-878s21c1
Sequence:CCGGGAGGTGGAGTCTGAGCTAAATCTCGAGATTTAGCTCAGACTCCACCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014563    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004554.3-3416s1c1
Sequence:CCGGGCCCAGAAGTTGGAAAGAGATCTCGAGATCTCTTTCCAACTTCTGGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004554.3-1877s1c1
Sequence:CCGGCGGAATTCAGACATTGAGCTTCTCGAGAAGCTCAATGTCTGAATTCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004554.3-2318s1c1
Sequence:CCGGCCTACCCAGAGTTTCAGGTTTCTCGAGAAACCTGAAACTCTGGGTAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004554.3-2481s1c1
Sequence:CCGGCTTGCGAAACTCCTTACCTATCTCGAGATAGGTAAGGAGTTTCGCAAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014564    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004554.3-319s1c1
Sequence:CCGGGCTGGAATTTAAGCTGGTGTTCTCGAGAACACCAGCTTAAATTCCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)