EMAIL THIS PAGE TO A FRIEND

NFE2

nuclear factor, erythroid 2

57 Gene Product Result for
Synonyms: NF-E2 p45
UniProtKB ID: Q16621, Q07720, Q6ICV9
Gene ID:
Mouse(18022) nuclear factor, erythroid derived 2
Rat(366998) nuclear factor, erythroid derived 2
Zebrafish(317765) nuclear factor, erythroid-derived 2
domestic cat(101101233) nuclear factor (erythroid-derived 2), 45kDa
cow(514006) nuclear factor (erythroid-derived 2), 45kDa
dog(486495) nuclear factor (erythroid-derived 2), 45kDa
naked mole-rat(101712062) nuclear factor (erythroid-derived 2), 45kDa
domestic guinea pig(100726687) nuclear factor (erythroid-derived 2), 45kDa
sheep(101120229) nuclear factor (erythroid-derived 2), 45kDa
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008685 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008685 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008685 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006163 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006163 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006163 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006163 Rosetta Predictions human pricing
NM_001012224 Rosetta Predictions rat pricing
XM_576348 Rosetta Predictions rat pricing
NM_008685 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006163 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00138534 predicted 699
2 SASI_Hs01_00138535 predicted 781
3 SASI_Hs01_00138536 predicted 985
4 SASI_Hs01_00138537 predicted 385
5 SASI_Hs01_00138538 predicted 1295
6 SASI_Hs01_00138539 predicted 1170
7 SASI_Hs01_00138540 predicted 1385
8 SASI_Hs02_00341014 predicted 720
9 SASI_Hs01_00138541 predicted 696
10 SASI_Hs01_00138542 predicted 711
11 SASI_Hs01_00138543 predicted 1293
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012224 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00092147 predicted 728
2 SASI_Rn01_00092148 predicted 1071
3 SASI_Rn01_00092150 predicted 899
4 SASI_Rn01_00092151 predicted 847
5 SASI_Rn01_00092152 predicted 1317
6 SASI_Rn01_00092153 predicted 762
7 SASI_Rn01_00092154 predicted 375
8 SASI_Rn01_00092155 predicted 417
9 SASI_Rn02_00200482 predicted 750
10 SASI_Rn01_00092156 predicted 845
11 SASI_Rn01_00092149 predicted 339
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_576348 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00146745 predicted 1566
2 SASI_Rn01_00146746 predicted 1660
3 SASI_Rn01_00146747 predicted 359
4 SASI_Rn01_00146748 predicted 915
5 SASI_Rn01_00146749 predicted 866
6 SASI_Rn01_00146750 predicted 751
7 SASI_Rn01_00146751 predicted 1467
8 SASI_Rn01_00146752 predicted 790
9 SASI_Rn01_00146753 predicted 393
10 SASI_Rn01_00146754 predicted 1339
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008685 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00141170 predicted 523
2 SASI_Mm01_00141171 predicted 429
3 SASI_Mm01_00141173 predicted 765
4 SASI_Mm01_00141174 predicted 1224
5 SASI_Mm01_00141175 predicted 740
6 SASI_Mm01_00141176 predicted 655
7 SASI_Mm01_00141178 predicted 630
8 SASI_Mm01_00141179 predicted 852
9 SASI_Mm02_00314479 predicted 752
10 SASI_Mm02_00314480 predicted 750
11 SASI_Mm01_00141172 predicted 352
12 SASI_Mm01_00141177 predicted 401
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008685
NFE2 MISSION shRNA Bacterial Glycerol Stock
nuclear factor, erythroid 2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000433121    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008685.2-426s21c1
Sequence:CCGGACTGAGCTGCAGGGTCTAAATCTCGAGATTTAGACCCTGCAGCTCAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424174    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008685.2-887s21c1
Sequence:CCGGTTTGGCCCATCCCAACTATACCTCGAGGTATAGTTGGGATGGGCCAAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430469    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008685.2-1493s21c1
Sequence:CCGGTCTGATGAAGGCACTTCTTAACTCGAGTTAAGAAGTGCCTTCATCAGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425519    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008685.2-499s21c1
Sequence:CCGGCACTGCCACCTCCAACATATTCTCGAGAATATGTTGGAGGTGGCAGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008685.2-1302s1c1
Sequence:CCGGGCAGAGCTGTACCATGATATTCTCGAGAATATCATGGTACAGCTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008685.2-747s1c1
Sequence:CCGGCCAGAATCTGACTCAGGATTACTCGAGTAATCCTGAGTCAGATTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008685.2-865s1c1
Sequence:CCGGCTTACTCACTTATGCCCAATTCTCGAGAATTGGGCATAAGTGAGTAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081983    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008685.2-1557s1c1
Sequence:CCGGCCATATCACCTGGGAGTATTTCTCGAGAAATACTCCCAGGTGATATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008685.2-864s1c1
Sequence:CCGGCCTTACTCACTTATGCCCAATCTCGAGATTGGGCATAAGTGAGTAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008685
NFE2 MISSION shRNA shRNA Plasmid DNA
nuclear factor, erythroid 2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000433121    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008685.2-426s21c1
Sequence:CCGGACTGAGCTGCAGGGTCTAAATCTCGAGATTTAGACCCTGCAGCTCAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424174    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008685.2-887s21c1
Sequence:CCGGTTTGGCCCATCCCAACTATACCTCGAGGTATAGTTGGGATGGGCCAAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430469    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008685.2-1493s21c1
Sequence:CCGGTCTGATGAAGGCACTTCTTAACTCGAGTTAAGAAGTGCCTTCATCAGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425519    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008685.2-499s21c1
Sequence:CCGGCACTGCCACCTCCAACATATTCTCGAGAATATGTTGGAGGTGGCAGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008685.2-1302s1c1
Sequence:CCGGGCAGAGCTGTACCATGATATTCTCGAGAATATCATGGTACAGCTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008685.2-747s1c1
Sequence:CCGGCCAGAATCTGACTCAGGATTACTCGAGTAATCCTGAGTCAGATTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008685.2-865s1c1
Sequence:CCGGCTTACTCACTTATGCCCAATTCTCGAGAATTGGGCATAAGTGAGTAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081983    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008685.2-1557s1c1
Sequence:CCGGCCATATCACCTGGGAGTATTTCTCGAGAAATACTCCCAGGTGATATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008685.2-864s1c1
Sequence:CCGGCCTTACTCACTTATGCCCAATCTCGAGATTGGGCATAAGTGAGTAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008685
NFE2 MISSION shRNA Lentiviral Transduction Particles
nuclear factor, erythroid 2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000433121    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008685.2-426s21c1
Sequence:CCGGACTGAGCTGCAGGGTCTAAATCTCGAGATTTAGACCCTGCAGCTCAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424174    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008685.2-887s21c1
Sequence:CCGGTTTGGCCCATCCCAACTATACCTCGAGGTATAGTTGGGATGGGCCAAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430469    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008685.2-1493s21c1
Sequence:CCGGTCTGATGAAGGCACTTCTTAACTCGAGTTAAGAAGTGCCTTCATCAGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425519    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008685.2-499s21c1
Sequence:CCGGCACTGCCACCTCCAACATATTCTCGAGAATATGTTGGAGGTGGCAGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008685.2-1302s1c1
Sequence:CCGGGCAGAGCTGTACCATGATATTCTCGAGAATATCATGGTACAGCTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008685.2-747s1c1
Sequence:CCGGCCAGAATCTGACTCAGGATTACTCGAGTAATCCTGAGTCAGATTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008685.2-865s1c1
Sequence:CCGGCTTACTCACTTATGCCCAATTCTCGAGAATTGGGCATAAGTGAGTAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081983    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008685.2-1557s1c1
Sequence:CCGGCCATATCACCTGGGAGTATTTCTCGAGAAATACTCCCAGGTGATATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008685.2-864s1c1
Sequence:CCGGCCTTACTCACTTATGCCCAATCTCGAGATTGGGCATAAGTGAGTAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006163
NFE2 MISSION shRNA Bacterial Glycerol Stock
nuclear factor, erythroid 2
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000430030    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006163.1-503s21c1
Sequence:CCGGCACTTCCTCCACCACCTTATGCTCGAGCATAAGGTGGTGGAGGAAGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413838    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006163.1-1015s21c1
Sequence:CCGGGATGACTTTAATGAGCTATTGCTCGAGCAATAGCTCATTAAAGTCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014588    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006163.1-1418s1c1
Sequence:CCGGGCTGATGGGATTTCCTTCATTCTCGAGAATGAAGGAAATCCCATCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014589    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006163.1-777s1c1
Sequence:CCGGGCGCAGCGAATATGTAGAGATCTCGAGATCTCTACATATTCGCTGCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006163.1-397s1c1
Sequence:CCGGGCTCCAAGTGAGCCATCATTTCTCGAGAAATGATGGCTCACTTGGAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006163.1-1312s1c1
Sequence:CCGGCCTGAAGAGTACGCGCTGCAACTCGAGTTGCAGCGCGTACTCTTCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006163.1-558s1c1
Sequence:CCGGCCCATACTCCTATGGCAACATCTCGAGATGTTGCCATAGGAGTATGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006163
NFE2 MISSION shRNA shRNA Plasmid DNA
nuclear factor, erythroid 2
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000430030    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006163.1-503s21c1
Sequence:CCGGCACTTCCTCCACCACCTTATGCTCGAGCATAAGGTGGTGGAGGAAGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413838    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006163.1-1015s21c1
Sequence:CCGGGATGACTTTAATGAGCTATTGCTCGAGCAATAGCTCATTAAAGTCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014588    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006163.1-1418s1c1
Sequence:CCGGGCTGATGGGATTTCCTTCATTCTCGAGAATGAAGGAAATCCCATCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014589    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006163.1-777s1c1
Sequence:CCGGGCGCAGCGAATATGTAGAGATCTCGAGATCTCTACATATTCGCTGCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006163.1-397s1c1
Sequence:CCGGGCTCCAAGTGAGCCATCATTTCTCGAGAAATGATGGCTCACTTGGAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006163.1-1312s1c1
Sequence:CCGGCCTGAAGAGTACGCGCTGCAACTCGAGTTGCAGCGCGTACTCTTCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006163.1-558s1c1
Sequence:CCGGCCCATACTCCTATGGCAACATCTCGAGATGTTGCCATAGGAGTATGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006163
NFE2 MISSION shRNA Lentiviral Transduction Particles
nuclear factor, erythroid 2
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000430030    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006163.1-503s21c1
Sequence:CCGGCACTTCCTCCACCACCTTATGCTCGAGCATAAGGTGGTGGAGGAAGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413838    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006163.1-1015s21c1
Sequence:CCGGGATGACTTTAATGAGCTATTGCTCGAGCAATAGCTCATTAAAGTCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014588    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006163.1-1418s1c1
Sequence:CCGGGCTGATGGGATTTCCTTCATTCTCGAGAATGAAGGAAATCCCATCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014589    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006163.1-777s1c1
Sequence:CCGGGCGCAGCGAATATGTAGAGATCTCGAGATCTCTACATATTCGCTGCGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006163.1-397s1c1
Sequence:CCGGGCTCCAAGTGAGCCATCATTTCTCGAGAAATGATGGCTCACTTGGAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006163.1-1312s1c1
Sequence:CCGGCCTGAAGAGTACGCGCTGCAACTCGAGTTGCAGCGCGTACTCTTCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006163.1-558s1c1
Sequence:CCGGCCCATACTCCTATGGCAACATCTCGAGATGTTGCCATAGGAGTATGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)