EMAIL THIS PAGE TO A FRIEND

NFE2L1

nuclear factor, erythroid 2-like 1

173 Gene Product Result for
Synonyms: LCR-F1 NRF1 TCF11
UniProtKB ID: Q14494, D3DTU3, D3DTU5, Q12877, Q96FN6
Gene ID:
Human(4779) Summary: This gene encodes a protein that is involved in globin gene expression in erythrocytes. Confusion has occurred in bibliographic databases due to the shared symbol of NRF1 for this gene, NFE2L1, and for 'nuclear respiratory factor 1' which has an official symbol of NRF1. [provided by RefSeq, Jul 2008]
Mouse(18023) nuclear factor, erythroid derived 2,-like 1
Rat(360610) nuclear factor, erythroid derived 2,-like 1
sheep(101116413) nuclear factor (erythroid-derived 2)-like 1
domestic guinea pig(100716712) nuclear factor (erythroid-derived 2)-like 1
naked mole-rat(101703672) nuclear factor (erythroid-derived 2)-like 1
Domestic Rabbit(100348176) nuclear factor (erythroid-derived 2)-like 1
chicken(417987) nuclear factor (erythroid-derived 2)-like 1
cow(534582) nuclear factor (erythroid-derived 2)-like 1
domestic cat(101084497) nuclear factor (erythroid-derived 2)-like 1
dog(403692) nuclear factor (erythroid-derived 2)-like 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008686 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008686 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008686 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003204 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003204 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003204 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003204 Rosetta Predictions human pricing
NM_001108293 Rosetta Predictions rat pricing
NM_001130450 Rosetta Predictions mouse pricing
NM_001130451 Rosetta Predictions mouse pricing
NM_001130452 Rosetta Predictions mouse pricing
NM_001130453 Rosetta Predictions mouse pricing
NM_001130454 Rosetta Predictions mouse pricing
NM_008686 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003204 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00082559 predicted 1393
2 SASI_Hs01_00082560 predicted 1564
3 SASI_Hs02_00335244 predicted 1119
4 SASI_Hs01_00082561 predicted 759
5 SASI_Hs01_00082562 predicted 2796
6 SASI_Hs01_00082563 predicted 1088
7 SASI_Hs01_00082564 predicted 800
8 SASI_Hs01_00082565 predicted 1081
9 SASI_Hs01_00082566 predicted 1099
10 SASI_Hs01_00082567 predicted 2990
11 SASI_Hs01_00082568 predicted 2520
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108293 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00237229 predicted 1112
2 SASI_Rn02_00237230 predicted 869
3 SASI_Rn02_00237231 predicted 1040
4 SASI_Rn02_00237232 predicted 912
5 SASI_Rn02_00237233 predicted 1132
6 SASI_Rn02_00237234 predicted 248
7 SASI_Rn02_00237235 predicted 908
8 SASI_Rn02_00237236 predicted 221
9 SASI_Rn02_00237237 predicted 226
10 SASI_Rn02_00237238 predicted 228
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001130450 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00311218 predicted 1475
2 SASI_Mm02_00311219 predicted 1421
3 SASI_Mm02_00311220 predicted 2720
4 SASI_Mm02_00311221 predicted 2911
5 SASI_Mm02_00311222 predicted 2903
6 SASI_Mm02_00311223 predicted 1542
7 SASI_Mm02_00311224 predicted 2707
8 SASI_Mm02_00311225 predicted 2383
9 SASI_Mm02_00311226 predicted 2404
10 SASI_Mm02_00311227 predicted 2527
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001130451 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00311228 predicted 2061
2 SASI_Mm02_00311229 predicted 416
3 SASI_Mm02_00311230 predicted 1653
4 SASI_Mm02_00311231 predicted 1853
5 SASI_Mm02_00311232 predicted 1841
6 SASI_Mm02_00311233 predicted 477
7 SASI_Mm02_00311234 predicted 1640
8 SASI_Mm02_00311235 predicted 1322
9 SASI_Mm02_00311236 predicted 1331
10 SASI_Mm02_00311237 predicted 1470
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001130452 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00311238 predicted 2028
2 SASI_Mm02_00311239 predicted 382
3 SASI_Mm02_00311240 predicted 1613
4 SASI_Mm02_00311241 predicted 1813
5 SASI_Mm02_00311242 predicted 1801
6 SASI_Mm02_00311243 predicted 445
7 SASI_Mm02_00311244 predicted 1609
8 SASI_Mm02_00311245 predicted 1283
9 SASI_Mm02_00311246 predicted 1296
10 SASI_Mm02_00311247 predicted 1429
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001130453 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00311248 predicted 430
2 SASI_Mm02_00311249 predicted 378
3 SASI_Mm02_00311250 predicted 1666
4 SASI_Mm02_00311251 predicted 1864
5 SASI_Mm02_00311252 predicted 1856
6 SASI_Mm02_00311253 predicted 492
7 SASI_Mm02_00311254 predicted 1660
8 SASI_Mm02_00311255 predicted 1336
9 SASI_Mm02_00311256 predicted 1351
10 SASI_Mm02_00311257 predicted 1485
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001130454 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00311258 predicted 400
2 SASI_Mm02_00311259 predicted 346
3 SASI_Mm02_00311260 predicted 1631
4 SASI_Mm02_00311261 predicted 1835
5 SASI_Mm02_00311262 predicted 1823
6 SASI_Mm02_00311263 predicted 463
7 SASI_Mm02_00311264 predicted 1623
8 SASI_Mm02_00311265 predicted 1304
9 SASI_Mm02_00311266 predicted 1313
10 SASI_Mm02_00311267 predicted 1452
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008686 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00314481 predicted 1539
2 SASI_Mm01_00180397 predicted 1478
3 SASI_Mm01_00180398 predicted 2771
4 SASI_Mm02_00314482 predicted 2970
5 SASI_Mm01_00180401 predicted 2958
6 SASI_Mm02_00314483 predicted 1603
7 SASI_Mm01_00180402 predicted 2767
8 SASI_Mm02_00314484 predicted 2449
9 SASI_Mm01_00180403 predicted 2453
10 SASI_Mm02_00314485 predicted 2587
11 SASI_Mm01_00180395 predicted 743
12 SASI_Mm01_00180396 predicted 423
13 SASI_Mm01_00180399 predicted 456
14 SASI_Mm01_00180400 predicted 746
15 SASI_Mm01_00180404 predicted 758
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008686
VALIDATED
NFE2L1 MISSION shRNA Bacterial Glycerol Stock
nuclear factor, erythroid 2-like 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000232249    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008686.2-1862s21c1
Sequence:CCGGGCATGTGGGCCACAATCATACCTCGAGGTATGATTGTGGCCCACATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232250    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008686.2-2069s21c1
Sequence:CCGGCAATGAGCTGCTGTCCAAATACTCGAGTATTTGGACAGCAGCTCATTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075343    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008686.2-3016s1c1
Sequence:CCGGGCACCTGTAATATCTTAGTTACTCGAGTAACTAAGATATTACAGGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008686.2-1870s1c1
Sequence:CCGGGCCACAATCATACATACAATACTCGAGTATTGTATGTATGATTGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075347    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008686.2-2024s1c1
Sequence:CCGGCCCATTCACCAATGACAAGATCTCGAGATCTTGTCATTGGTGAATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075346    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008686.2-1118s1c1
Sequence:CCGGCATCATGGAAATGCAGGCTATCTCGAGATAGCCTGCATTTCCATGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075345    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008686.2-686s1c1
Sequence:CCGGGCAGGGATTCGGTGAAGATTTCTCGAGAAATCTTCACCGAATCCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232247    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008686.2-459s21c1
Sequence:CCGGAGCATAGACCTGGACAATTACCTCGAGGTAATTGTCCAGGTCTATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232251    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008686.2-3625s21c1
Sequence:CCGGGCCATAAAGACTCCGTGTTAACTCGAGTTAACACGGAGTCTTTATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232248    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008686.2-1840s21c1
Sequence:CCGGTCTCTTGCCTTCCCTACTTAGCTCGAGCTAAGTAGGGAAGGCAAGAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008686
VALIDATED
NFE2L1 MISSION shRNA shRNA Plasmid DNA
nuclear factor, erythroid 2-like 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000232249    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008686.2-1862s21c1
Sequence:CCGGGCATGTGGGCCACAATCATACCTCGAGGTATGATTGTGGCCCACATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232250    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008686.2-2069s21c1
Sequence:CCGGCAATGAGCTGCTGTCCAAATACTCGAGTATTTGGACAGCAGCTCATTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075343    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008686.2-3016s1c1
Sequence:CCGGGCACCTGTAATATCTTAGTTACTCGAGTAACTAAGATATTACAGGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008686.2-1870s1c1
Sequence:CCGGGCCACAATCATACATACAATACTCGAGTATTGTATGTATGATTGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075347    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008686.2-2024s1c1
Sequence:CCGGCCCATTCACCAATGACAAGATCTCGAGATCTTGTCATTGGTGAATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075346    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008686.2-1118s1c1
Sequence:CCGGCATCATGGAAATGCAGGCTATCTCGAGATAGCCTGCATTTCCATGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075345    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008686.2-686s1c1
Sequence:CCGGGCAGGGATTCGGTGAAGATTTCTCGAGAAATCTTCACCGAATCCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232247    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008686.2-459s21c1
Sequence:CCGGAGCATAGACCTGGACAATTACCTCGAGGTAATTGTCCAGGTCTATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232251    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008686.2-3625s21c1
Sequence:CCGGGCCATAAAGACTCCGTGTTAACTCGAGTTAACACGGAGTCTTTATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232248    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008686.2-1840s21c1
Sequence:CCGGTCTCTTGCCTTCCCTACTTAGCTCGAGCTAAGTAGGGAAGGCAAGAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008686
VALIDATED
NFE2L1 MISSION shRNA Lentiviral Transduction Particles
nuclear factor, erythroid 2-like 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000232249    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008686.2-1862s21c1
Sequence:CCGGGCATGTGGGCCACAATCATACCTCGAGGTATGATTGTGGCCCACATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232250    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008686.2-2069s21c1
Sequence:CCGGCAATGAGCTGCTGTCCAAATACTCGAGTATTTGGACAGCAGCTCATTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075343    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008686.2-3016s1c1
Sequence:CCGGGCACCTGTAATATCTTAGTTACTCGAGTAACTAAGATATTACAGGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008686.2-1870s1c1
Sequence:CCGGGCCACAATCATACATACAATACTCGAGTATTGTATGTATGATTGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075347    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008686.2-2024s1c1
Sequence:CCGGCCCATTCACCAATGACAAGATCTCGAGATCTTGTCATTGGTGAATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075346    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008686.2-1118s1c1
Sequence:CCGGCATCATGGAAATGCAGGCTATCTCGAGATAGCCTGCATTTCCATGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075345    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008686.2-686s1c1
Sequence:CCGGGCAGGGATTCGGTGAAGATTTCTCGAGAAATCTTCACCGAATCCCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232247    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008686.2-459s21c1
Sequence:CCGGAGCATAGACCTGGACAATTACCTCGAGGTAATTGTCCAGGTCTATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232251    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008686.2-3625s21c1
Sequence:CCGGGCCATAAAGACTCCGTGTTAACTCGAGTTAACACGGAGTCTTTATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232248    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008686.2-1840s21c1
Sequence:CCGGTCTCTTGCCTTCCCTACTTAGCTCGAGCTAAGTAGGGAAGGCAAGAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003204
VALIDATED
NFE2L1 MISSION shRNA Bacterial Glycerol Stock
nuclear factor, erythroid 2-like 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000014623    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_003204.1-3600s1c1
Sequence:CCGGGCTTTGAGATTTAGAGTCAAACTCGAGTTTGACTCTAAATCTCAAAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014626    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_003204.1-2224s1c1
Sequence:CCGGCCAGCCTGAGTATTCCAAGTTCTCGAGAACTTGGAATACTCAGGCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014625    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_003204.1-1425s1c1
Sequence:CCGGGCATAACAGAAGCAGTGCCTACTCGAGTAGGCACTGCTTCTGTTATGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014624    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_003204.1-1039s1c1
Sequence:CCGGCGGTGAAGATTTGGAGGATTTCTCGAGAAATCCTCCAAATCTTCACCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014627    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_003204.1-757s1c1
Sequence:CCGGCCACAACCTGAGGAATACCTTCTCGAGAAGGTATTCCTCAGGTTGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280412    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_003204.2-3659s21c1
Sequence:CCGGGCTTTGAGATTTAGAGTCAAACTCGAGTTTGACTCTAAATCTCAAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000297814    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_003204.2-1098s21c1
Sequence:CCGGCGGTGAAGATTTGGAGGATTTCTCGAGAAATCCTCCAAATCTTCACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280355    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_003204.2-816s21c1
Sequence:CCGGCCACAACCTGAGGAATACCTTCTCGAGAAGGTATTCCTCAGGTTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280409    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_003204.2-862s21c1
Sequence:CCGGAGCATAGACCTGGACAATTACCTCGAGGTAATTGTCCAGGTCTATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280354    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_003204.2-2283s21c1
Sequence:CCGGCCAGCCTGAGTATTCCAAGTTCTCGAGAACTTGGAATACTCAGGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003204
VALIDATED
NFE2L1 MISSION shRNA shRNA Plasmid DNA
nuclear factor, erythroid 2-like 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000014623    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_003204.1-3600s1c1
Sequence:CCGGGCTTTGAGATTTAGAGTCAAACTCGAGTTTGACTCTAAATCTCAAAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014626    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_003204.1-2224s1c1
Sequence:CCGGCCAGCCTGAGTATTCCAAGTTCTCGAGAACTTGGAATACTCAGGCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014625    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_003204.1-1425s1c1
Sequence:CCGGGCATAACAGAAGCAGTGCCTACTCGAGTAGGCACTGCTTCTGTTATGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014624    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_003204.1-1039s1c1
Sequence:CCGGCGGTGAAGATTTGGAGGATTTCTCGAGAAATCCTCCAAATCTTCACCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014627    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_003204.1-757s1c1
Sequence:CCGGCCACAACCTGAGGAATACCTTCTCGAGAAGGTATTCCTCAGGTTGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000280412    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_003204.2-3659s21c1
Sequence:CCGGGCTTTGAGATTTAGAGTCAAACTCGAGTTTGACTCTAAATCTCAAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000297814    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_003204.2-1098s21c1
Sequence:CCGGCGGTGAAGATTTGGAGGATTTCTCGAGAAATCCTCCAAATCTTCACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000280355    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_003204.2-816s21c1
Sequence:CCGGCCACAACCTGAGGAATACCTTCTCGAGAAGGTATTCCTCAGGTTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000280409    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_003204.2-862s21c1
Sequence:CCGGAGCATAGACCTGGACAATTACCTCGAGGTAATTGTCCAGGTCTATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000280354    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_003204.2-2283s21c1
Sequence:CCGGCCAGCCTGAGTATTCCAAGTTCTCGAGAACTTGGAATACTCAGGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003204
VALIDATED
NFE2L1 MISSION shRNA Lentiviral Transduction Particles
nuclear factor, erythroid 2-like 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000014623    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_003204.1-3600s1c1
Sequence:CCGGGCTTTGAGATTTAGAGTCAAACTCGAGTTTGACTCTAAATCTCAAAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014626    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_003204.1-2224s1c1
Sequence:CCGGCCAGCCTGAGTATTCCAAGTTCTCGAGAACTTGGAATACTCAGGCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014625    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_003204.1-1425s1c1
Sequence:CCGGGCATAACAGAAGCAGTGCCTACTCGAGTAGGCACTGCTTCTGTTATGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014624    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_003204.1-1039s1c1
Sequence:CCGGCGGTGAAGATTTGGAGGATTTCTCGAGAAATCCTCCAAATCTTCACCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014627    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_003204.1-757s1c1
Sequence:CCGGCCACAACCTGAGGAATACCTTCTCGAGAAGGTATTCCTCAGGTTGTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280412    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_003204.2-3659s21c1
Sequence:CCGGGCTTTGAGATTTAGAGTCAAACTCGAGTTTGACTCTAAATCTCAAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000297814    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_003204.2-1098s21c1
Sequence:CCGGCGGTGAAGATTTGGAGGATTTCTCGAGAAATCCTCCAAATCTTCACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280355    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_003204.2-816s21c1
Sequence:CCGGCCACAACCTGAGGAATACCTTCTCGAGAAGGTATTCCTCAGGTTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280409    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_003204.2-862s21c1
Sequence:CCGGAGCATAGACCTGGACAATTACCTCGAGGTAATTGTCCAGGTCTATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280354    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_003204.2-2283s21c1
Sequence:CCGGCCAGCCTGAGTATTCCAAGTTCTCGAGAACTTGGAATACTCAGGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)