EMAIL THIS PAGE TO A FRIEND

NFE2L2

nuclear factor, erythroid 2-like 2

99 Gene Product Result for
Synonyms: NRF2
Gene ID:
Human(4780) Summary: This gene encodes a transcription factor which is a member of a small family of basic leucine zipper (bZIP) proteins. The encoded transcription factor regulates genes which contain antioxidant response elements (ARE) in their promoters; many of these genes encode proteins involved in response to injury and inflammation which includes the production of free radicals. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2012]
Mouse(18024) nuclear factor, erythroid derived 2, like 2
Rat(83619) nuclear factor, erythroid derived 2, like 2
chicken(396014) nuclear factor (erythroid-derived 2)-like 2
cow(497024) nuclear factor (erythroid-derived 2)-like 2
Horse(100066816) nuclear factor (erythroid-derived 2)-like 2
domestic cat(101098812) nuclear factor (erythroid-derived 2)-like 2
dog(478813) nuclear factor (erythroid-derived 2)-like 2
Domestic Rabbit(100353014) nuclear factor (erythroid-derived 2)-like 2
naked mole-rat(101698153) nuclear factor (erythroid-derived 2)-like 2
domestic guinea pig(100734862) nuclear factor (erythroid-derived 2)-like 2
sheep(101104966) nuclear factor (erythroid-derived 2)-like 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2108520 Anti-NFE2L2 IgG fraction of antiserum pig, guinea pig, bovine, rabbit, pig, human, horse, mouse, rat
western blot pricing
SAB2501713 Anti-NFE2L2 antibody produced in goat affinity isolated antibody, buffered aqueous solution mouse, rat, canine, human, pig, bovine
ELISA, western blot pricing
HPA002990 Anti-NFE2L2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution Antibody Enhanced Validation human
immunohistochemistry pricing
AV38745 Anti-NFE2L2 antibody produced in rabbit IgG fraction of antiserum rabbit, canine, mouse, guinea pig, bovine, human, rat, horse
western blot pricing
SAB2701989 Anti-NFE2L2 antibody produced in rabbit rat, mouse, human
ChIP, immunocytochemistry, immunofluorescence, immunohistochemistry, immunoprecipitation (IP), western blot pricing
HPA043438 Anti-NFE2L2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody human
immunofluorescence pricing
SAB4501984 Anti-NRF2, C-Terminal antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
WH0004780M1 Monoclonal Anti-NFE2L2 antibody produced in mouse clone 1F3, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1404123 Monoclonal Anti-NFE2L2 antibody produced in mouse clone 2G7, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing
SAB1409360 Monoclonal Anti-NFE2L2 antibody produced in mouse clone 3G7, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1409361 Monoclonal Anti-NFE2L2 antibody produced in mouse clone 2D5, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1409362 Monoclonal Anti-NFE2L2 antibody produced in mouse clone 4C3, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1409363 Monoclonal Anti-NFE2L2 antibody produced in mouse clone 1G10, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010902 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010902 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010902 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006164 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006164 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006164 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006164 Rosetta Predictions human pricing
NM_031789 Rosetta Predictions rat pricing
NM_010902 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006164 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00182393 predicted 1713
2 SASI_Hs02_00341015 predicted 1905
3 SASI_Hs01_00182394 predicted 1917
4 SASI_Hs01_00182395 predicted 2442
5 SASI_Hs02_00341016 predicted 792
6 SASI_Hs02_00341017 predicted 761
7 SASI_Hs01_00182396 predicted 1170
8 SASI_Hs02_00341018 predicted 1830
9 SASI_Hs01_00182400 predicted 1841
10 SASI_Hs01_00182401 predicted 2436
11 SASI_Hs01_00182392 predicted 1138
12 SASI_Hs01_00182397 predicted 667
13 SASI_Hs01_00182398 predicted 1219
14 SASI_Hs01_00182399 predicted 633
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031789 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00089762 predicted 1623
2 SASI_Rn01_00089763 predicted 1680
3 SASI_Rn01_00089764 predicted 629
4 SASI_Rn01_00089765 predicted 1524
5 SASI_Rn01_00089766 predicted 1767
6 SASI_Rn01_00089768 predicted 1911
7 SASI_Rn01_00089769 predicted 848
8 SASI_Rn01_00089770 predicted 593
9 SASI_Rn01_00089771 predicted 1825
10 SASI_Rn02_00265230 predicted 998
11 SASI_Rn01_00089767 predicted 782
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010902 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00130750 predicted 785
2 SASI_Mm01_00130751 predicted 1846
3 SASI_Mm02_00319623 predicted 2088
4 SASI_Mm02_00319624 predicted 1012
5 SASI_Mm01_00130752 predicted 605
6 SASI_Mm01_00130754 predicted 1883
7 SASI_Mm01_00130755 predicted 471
8 SASI_Mm01_00130756 predicted 2073
9 SASI_Mm01_00130757 predicted 757
10 SASI_Mm02_00319625 predicted 1994
11 SASI_Mm01_00130753 predicted 1448
12 SASI_Mm01_00130758 predicted 728
13 SASI_Mm01_00130759 predicted 1234
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010902
VALIDATED
NFE2L2 MISSION shRNA Bacterial Glycerol Stock
nuclear factor, erythroid 2-like 2
Mouse
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000012128    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010902.2-2068s1c1
Sequence:CCGGGCAGAATTATAGCCAAAGCTACTCGAGTAGCTTTGGCTATAATTCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012131    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010902.2-600s1c1
Sequence:CCGGCCACGCTGAAAGTTCAGTCTTCTCGAGAAGACTGAACTTTCAGCGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012130    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010902.2-1632s1c1
Sequence:CCGGGCTCGCATTGATCCGAGATATCTCGAGATATCTCGGATCAATGCGAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012129    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010902.2-733s1c1
Sequence:CCGGCCCGAATTACAGTGTCTTAATCTCGAGATTAAGACACTGTAATTCGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012132    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010902.2-213s1c1
Sequence:CCGGCCAGCAGGACATGGATTTGATCTCGAGATCAAATCCATGTCCTGCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054661    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010902.2-1147s1c1
Sequence:CCGGGAAGGCACAATGGAATTCAATCTCGAGATTGAATTCCATTGTGCCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054658    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010902.2-2080s1c1
Sequence:CCGGCCAAAGCTAGTATAGCAATAACTCGAGTTATTGCTATACTAGCTTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054659    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010902.2-1834s1c1
Sequence:CCGGCTTGAAGTCTTCAGCATGTTACTCGAGTAACATGCTGAAGACTTCAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054662    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010902.2-1872s1c1
Sequence:CCGGGCCTTACTCTCCCAGTGAATACTCGAGTATTCACTGGGAGAGTAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054660    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010902.2-297s1c1
Sequence:CCGGGCGACAGAAGGACTATGAGTTCTCGAGAACTCATAGTCCTTCTGTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304248    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010902.3-792s21c1
Sequence:CCGGCCCGAATTACAGTGTCTTAATCTCGAGATTAAGACACTGTAATTCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304249    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010902.3-1691s21c1
Sequence:CCGGGCTCGCATTGATCCGAGATATCTCGAGATATCTCGGATCAATGCGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301260    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010902.3-1893s21c1
Sequence:CCGGCTTGAAGTCTTCAGCATGTTACTCGAGTAACATGCTGAAGACTTCAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301179    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010902.3-1931s21c1
Sequence:CCGGGCCTTACTCTCCCAGTGAATACTCGAGTATTCACTGGGAGAGTAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301258    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010902.3-2139s21c1
Sequence:CCGGCCAAAGCTAGTATAGCAATAACTCGAGTTATTGCTATACTAGCTTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010902
VALIDATED
NFE2L2 MISSION shRNA shRNA Plasmid DNA
nuclear factor, erythroid 2-like 2
Mouse
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000012128    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010902.2-2068s1c1
Sequence:CCGGGCAGAATTATAGCCAAAGCTACTCGAGTAGCTTTGGCTATAATTCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012131    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010902.2-600s1c1
Sequence:CCGGCCACGCTGAAAGTTCAGTCTTCTCGAGAAGACTGAACTTTCAGCGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012130    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010902.2-1632s1c1
Sequence:CCGGGCTCGCATTGATCCGAGATATCTCGAGATATCTCGGATCAATGCGAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012129    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010902.2-733s1c1
Sequence:CCGGCCCGAATTACAGTGTCTTAATCTCGAGATTAAGACACTGTAATTCGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012132    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010902.2-213s1c1
Sequence:CCGGCCAGCAGGACATGGATTTGATCTCGAGATCAAATCCATGTCCTGCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054661    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010902.2-1147s1c1
Sequence:CCGGGAAGGCACAATGGAATTCAATCTCGAGATTGAATTCCATTGTGCCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054658    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010902.2-2080s1c1
Sequence:CCGGCCAAAGCTAGTATAGCAATAACTCGAGTTATTGCTATACTAGCTTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054659    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010902.2-1834s1c1
Sequence:CCGGCTTGAAGTCTTCAGCATGTTACTCGAGTAACATGCTGAAGACTTCAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054662    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010902.2-1872s1c1
Sequence:CCGGGCCTTACTCTCCCAGTGAATACTCGAGTATTCACTGGGAGAGTAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000054660    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010902.2-297s1c1
Sequence:CCGGGCGACAGAAGGACTATGAGTTCTCGAGAACTCATAGTCCTTCTGTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304248    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010902.3-792s21c1
Sequence:CCGGCCCGAATTACAGTGTCTTAATCTCGAGATTAAGACACTGTAATTCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304249    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010902.3-1691s21c1
Sequence:CCGGGCTCGCATTGATCCGAGATATCTCGAGATATCTCGGATCAATGCGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000301260    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010902.3-1893s21c1
Sequence:CCGGCTTGAAGTCTTCAGCATGTTACTCGAGTAACATGCTGAAGACTTCAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000301179    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010902.3-1931s21c1
Sequence:CCGGGCCTTACTCTCCCAGTGAATACTCGAGTATTCACTGGGAGAGTAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000301258    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010902.3-2139s21c1
Sequence:CCGGCCAAAGCTAGTATAGCAATAACTCGAGTTATTGCTATACTAGCTTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010902
VALIDATED
NFE2L2 MISSION shRNA Lentiviral Transduction Particles
nuclear factor, erythroid 2-like 2
Mouse
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000012128    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010902.2-2068s1c1
Sequence:CCGGGCAGAATTATAGCCAAAGCTACTCGAGTAGCTTTGGCTATAATTCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012131    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010902.2-600s1c1
Sequence:CCGGCCACGCTGAAAGTTCAGTCTTCTCGAGAAGACTGAACTTTCAGCGTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012130    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010902.2-1632s1c1
Sequence:CCGGGCTCGCATTGATCCGAGATATCTCGAGATATCTCGGATCAATGCGAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012129    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010902.2-733s1c1
Sequence:CCGGCCCGAATTACAGTGTCTTAATCTCGAGATTAAGACACTGTAATTCGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012132    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010902.2-213s1c1
Sequence:CCGGCCAGCAGGACATGGATTTGATCTCGAGATCAAATCCATGTCCTGCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054661    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010902.2-1147s1c1
Sequence:CCGGGAAGGCACAATGGAATTCAATCTCGAGATTGAATTCCATTGTGCCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054658    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010902.2-2080s1c1
Sequence:CCGGCCAAAGCTAGTATAGCAATAACTCGAGTTATTGCTATACTAGCTTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054659    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010902.2-1834s1c1
Sequence:CCGGCTTGAAGTCTTCAGCATGTTACTCGAGTAACATGCTGAAGACTTCAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054662    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010902.2-1872s1c1
Sequence:CCGGGCCTTACTCTCCCAGTGAATACTCGAGTATTCACTGGGAGAGTAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000054660    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010902.2-297s1c1
Sequence:CCGGGCGACAGAAGGACTATGAGTTCTCGAGAACTCATAGTCCTTCTGTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304248    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010902.3-792s21c1
Sequence:CCGGCCCGAATTACAGTGTCTTAATCTCGAGATTAAGACACTGTAATTCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304249    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010902.3-1691s21c1
Sequence:CCGGGCTCGCATTGATCCGAGATATCTCGAGATATCTCGGATCAATGCGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301260    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010902.3-1893s21c1
Sequence:CCGGCTTGAAGTCTTCAGCATGTTACTCGAGTAACATGCTGAAGACTTCAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301179    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010902.3-1931s21c1
Sequence:CCGGGCCTTACTCTCCCAGTGAATACTCGAGTATTCACTGGGAGAGTAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301258    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010902.3-2139s21c1
Sequence:CCGGCCAAAGCTAGTATAGCAATAACTCGAGTTATTGCTATACTAGCTTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006164
VALIDATED
NFE2L2 MISSION shRNA Bacterial Glycerol Stock
nuclear factor, erythroid 2-like 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000007555    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_006164.2-1987s1c1
Sequence:CCGGGCTCCTACTGTGATGTGAAATCTCGAGATTTCACATCACAGTAGGAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007558    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_006164.2-1144s1c1
Sequence:CCGGCCGGCATTTCACTAAACACAACTCGAGTTGTGTTTAGTGAAATGCCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007559    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_006164.2-1862s1c1
Sequence:CCGGGCAGCAAACAAGAGATGGCAACTCGAGTTGCCATCTCTTGTTTGCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007557    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_006164.2-632s1c1
Sequence:CCGGCCCTGTTGATTTAGACGGTATCTCGAGATACCGTCTAAATCAACAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007556    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_006164.2-1786s1c1
Sequence:CCGGGCACCTTATATCTCGAAGTTTCTCGAGAAACTTCGAGATATAAGGTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000284999    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 2 Clone ID:NM_006164.3-1586s21c1
Sequence:CCGGCCGGCATTTCACTAAACACAACTCGAGTTGTGTTTAGTGAAATGCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273494    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_006164.3-1113s21c1
Sequence:CCGGAGTTTGGGAGGAGCTATTATCCTCGAGGATAATAGCTCCTCCCAAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273552    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006164.3-2038s21c1
Sequence:CCGGCTTGCATTAATTCGGGATATACTCGAGTATATCCCGAATTAATGCAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281950    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006164.3-2130s21c1
Sequence:CCGGAGAGCAAGATTTAGATCATTTCTCGAGAAATGATCTAAATCTTGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000284998    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006164.3-2429s21c1
Sequence:CCGGGCTCCTACTGTGATGTGAAATCTCGAGATTTCACATCACAGTAGGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006164
VALIDATED
NFE2L2 MISSION shRNA shRNA Plasmid DNA
nuclear factor, erythroid 2-like 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000007555    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_006164.2-1987s1c1
Sequence:CCGGGCTCCTACTGTGATGTGAAATCTCGAGATTTCACATCACAGTAGGAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007558    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_006164.2-1144s1c1
Sequence:CCGGCCGGCATTTCACTAAACACAACTCGAGTTGTGTTTAGTGAAATGCCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007559    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_006164.2-1862s1c1
Sequence:CCGGGCAGCAAACAAGAGATGGCAACTCGAGTTGCCATCTCTTGTTTGCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007557    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_006164.2-632s1c1
Sequence:CCGGCCCTGTTGATTTAGACGGTATCTCGAGATACCGTCTAAATCAACAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007556    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_006164.2-1786s1c1
Sequence:CCGGGCACCTTATATCTCGAAGTTTCTCGAGAAACTTCGAGATATAAGGTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000284999    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 2 Clone ID:NM_006164.3-1586s21c1
Sequence:CCGGCCGGCATTTCACTAAACACAACTCGAGTTGTGTTTAGTGAAATGCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273494    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_006164.3-1113s21c1
Sequence:CCGGAGTTTGGGAGGAGCTATTATCCTCGAGGATAATAGCTCCTCCCAAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273552    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006164.3-2038s21c1
Sequence:CCGGCTTGCATTAATTCGGGATATACTCGAGTATATCCCGAATTAATGCAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000281950    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006164.3-2130s21c1
Sequence:CCGGAGAGCAAGATTTAGATCATTTCTCGAGAAATGATCTAAATCTTGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000284998    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006164.3-2429s21c1
Sequence:CCGGGCTCCTACTGTGATGTGAAATCTCGAGATTTCACATCACAGTAGGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006164
VALIDATED
NFE2L2 MISSION shRNA Lentiviral Transduction Particles
nuclear factor, erythroid 2-like 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000007555    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_006164.2-1987s1c1
Sequence:CCGGGCTCCTACTGTGATGTGAAATCTCGAGATTTCACATCACAGTAGGAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007558    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_006164.2-1144s1c1
Sequence:CCGGCCGGCATTTCACTAAACACAACTCGAGTTGTGTTTAGTGAAATGCCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007559    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_006164.2-1862s1c1
Sequence:CCGGGCAGCAAACAAGAGATGGCAACTCGAGTTGCCATCTCTTGTTTGCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007557    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_006164.2-632s1c1
Sequence:CCGGCCCTGTTGATTTAGACGGTATCTCGAGATACCGTCTAAATCAACAGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007556    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_006164.2-1786s1c1
Sequence:CCGGGCACCTTATATCTCGAAGTTTCTCGAGAAACTTCGAGATATAAGGTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000284999    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 2 Clone ID:NM_006164.3-1586s21c1
Sequence:CCGGCCGGCATTTCACTAAACACAACTCGAGTTGTGTTTAGTGAAATGCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273494    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_006164.3-1113s21c1
Sequence:CCGGAGTTTGGGAGGAGCTATTATCCTCGAGGATAATAGCTCCTCCCAAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273552    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006164.3-2038s21c1
Sequence:CCGGCTTGCATTAATTCGGGATATACTCGAGTATATCCCGAATTAATGCAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281950    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006164.3-2130s21c1
Sequence:CCGGAGAGCAAGATTTAGATCATTTCTCGAGAAATGATCTAAATCTTGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000284998    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006164.3-2429s21c1
Sequence:CCGGGCTCCTACTGTGATGTGAAATCTCGAGATTTCACATCACAGTAGGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)