EMAIL THIS PAGE TO A FRIEND

NFE2L3

nuclear factor, erythroid 2-like 3

56 Gene Product Result for
Synonyms: NRF3
UniProtKB ID: Q9Y4A8, Q6NUS0, Q7Z498, Q86UJ4, Q86VR5, Q9UQA4
Gene ID:
Human(9603) Summary: This gene encodes a member of the cap 'n' collar basic-region leucine zipper family of transcription factors. The encoded protein heterodimerizes with small musculoaponeurotic fibrosarcoma factors to bind antioxidant response elements in target genes. This protein is a membrane bound glycoprotein that is targeted to the endoplasmic reticulum and the nuclear envelope. Pseudogenes of this gene are found on chromosomes 16, 17, and 18. [provided by RefSeq, Mar 2009]
Mouse(18025) nuclear factor, erythroid derived 2, like 3
Rat(312331) nuclear factor, erythroid derived 2, like 3
Zebrafish(406512) nuclear factor (erythroid-derived 2)-like 3
cow(510807) nuclear factor (erythroid-derived 2)-like 3
Horse(100068518) nuclear factor (erythroid-derived 2)-like 3
domestic cat(101082479) nuclear factor (erythroid-derived 2)-like 3
dog(482364) nuclear factor (erythroid-derived 2)-like 3
sheep(101115536) nuclear factor (erythroid-derived 2)-like 3
domestic guinea pig(100713741) nuclear factor (erythroid-derived 2)-like 3
naked mole-rat(101715653) nuclear factor (erythroid-derived 2)-like 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV33727 Anti-NFE2L3 antibody produced in rabbit affinity isolated antibody rabbit, human, bovine, guinea pig, rat, mouse
western blot pricing
HPA055889 Anti-NFE2L3 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004289 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004289 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004289 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010903 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010903 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010903 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004289 Rosetta Predictions human pricing
XM_001058195 Rosetta Predictions rat pricing
XM_231763 Rosetta Predictions rat pricing
NM_010903 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004289 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00337288 predicted 1875
2 SASI_Hs01_00183866 predicted 1090
3 SASI_Hs01_00183867 predicted 1330
4 SASI_Hs02_00337289 predicted 2172
5 SASI_Hs02_00337290 predicted 2353
6 SASI_Hs01_00183873 predicted 910
7 SASI_Hs02_00337291 predicted 1729
8 SASI_Hs01_00183874 predicted 1014
9 SASI_Hs02_00337292 predicted 1493
10 SASI_Hs02_00337293 predicted 1867
11 SASI_Hs01_00183865 predicted 2423
12 SASI_Hs01_00183868 predicted 1147
13 SASI_Hs01_00183869 predicted 1256
14 SASI_Hs01_00183870 predicted 1950
15 SASI_Hs01_00183871 predicted 1214
16 SASI_Hs01_00183872 predicted 1711
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001058195 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00288942 predicted 1060
2 SASI_Rn02_00288943 predicted 1294
3 SASI_Rn02_00288944 predicted 1190
4 SASI_Rn02_00288945 predicted 956
5 SASI_Rn02_00288946 predicted 1003
6 SASI_Rn02_00288947 predicted 1766
7 SASI_Rn02_00288948 predicted 1584
8 SASI_Rn02_00288949 predicted 1092
9 SASI_Rn02_00288950 predicted 1469
10 SASI_Rn02_00288951 predicted 1396
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_231763 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00386931 predicted 1595
2 SASI_Rn02_00386932 predicted 1888
3 SASI_Rn02_00386933 predicted 1793
4 SASI_Rn02_00386934 predicted 1614
5 SASI_Rn02_00386935 predicted 1492
6 SASI_Rn02_00386936 predicted 1422
7 SASI_Rn02_00386937 predicted 1905
8 SASI_Rn02_00386938 predicted 1530
9 SASI_Rn02_00386939 predicted 1714
10 SASI_Rn02_00386940 predicted 1737
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010903 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00069370 predicted 1188
2 SASI_Mm01_00069371 predicted 1826
3 SASI_Mm01_00069372 predicted 2310
4 SASI_Mm01_00069373 predicted 2290
5 SASI_Mm01_00069374 predicted 1841
6 SASI_Mm01_00069375 predicted 2006
7 SASI_Mm01_00069376 predicted 1085
8 SASI_Mm01_00069377 predicted 1200
9 SASI_Mm01_00069378 predicted 1418
10 SASI_Mm01_00069379 predicted 922
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004289
NFE2L3 MISSION shRNA Bacterial Glycerol Stock
nuclear factor, erythroid 2-like 3
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000430385    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004289.6-351s21c1
Sequence:CCGGCGCGTAGACCTAGATCTTTACCTCGAGGTAAAGATCTAGGTCTACGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420401    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004289.6-1443s21c1
Sequence:CCGGGAGATAAACTTAATGTCATTGCTCGAGCAATGACATTAAGTTTATCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426286    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004289.6-1963s21c1
Sequence:CCGGGCATGTTAAGTAGATATTATCCTCGAGGATAATATCTACTTAACATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013488    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004289.5-2452s1c1
Sequence:CCGGGCTACTTGAATAACTCAGTTACTCGAGTAACTGAGTTATTCAAGTAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004289.5-1330s1c1
Sequence:CCGGTGGAACTAATTTGACAGGATTCTCGAGAATCCTGTCAAATTAGTTCCATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004289.5-2225s1c1
Sequence:CCGGCCAGTCAATCCCAACCACTATCTCGAGATAGTGGTTGGGATTGACTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004289.5-1853s1c1
Sequence:CCGGGATAGAAACTTGAGCCGTGATCTCGAGATCACGGCTCAAGTTTCTATCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013490    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004289.5-1046s1c1
Sequence:CCGGGAAGACTTATTCCAGTTGCTTCTCGAGAAGCAACTGGAATAAGTCTTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004289
NFE2L3 MISSION shRNA shRNA Plasmid DNA
nuclear factor, erythroid 2-like 3
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000430385    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004289.6-351s21c1
Sequence:CCGGCGCGTAGACCTAGATCTTTACCTCGAGGTAAAGATCTAGGTCTACGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420401    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004289.6-1443s21c1
Sequence:CCGGGAGATAAACTTAATGTCATTGCTCGAGCAATGACATTAAGTTTATCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426286    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004289.6-1963s21c1
Sequence:CCGGGCATGTTAAGTAGATATTATCCTCGAGGATAATATCTACTTAACATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013488    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004289.5-2452s1c1
Sequence:CCGGGCTACTTGAATAACTCAGTTACTCGAGTAACTGAGTTATTCAAGTAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004289.5-1330s1c1
Sequence:CCGGTGGAACTAATTTGACAGGATTCTCGAGAATCCTGTCAAATTAGTTCCATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004289.5-2225s1c1
Sequence:CCGGCCAGTCAATCCCAACCACTATCTCGAGATAGTGGTTGGGATTGACTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004289.5-1853s1c1
Sequence:CCGGGATAGAAACTTGAGCCGTGATCTCGAGATCACGGCTCAAGTTTCTATCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013490    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004289.5-1046s1c1
Sequence:CCGGGAAGACTTATTCCAGTTGCTTCTCGAGAAGCAACTGGAATAAGTCTTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004289
NFE2L3 MISSION shRNA Lentiviral Transduction Particles
nuclear factor, erythroid 2-like 3
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000430385    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004289.6-351s21c1
Sequence:CCGGCGCGTAGACCTAGATCTTTACCTCGAGGTAAAGATCTAGGTCTACGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420401    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004289.6-1443s21c1
Sequence:CCGGGAGATAAACTTAATGTCATTGCTCGAGCAATGACATTAAGTTTATCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426286    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004289.6-1963s21c1
Sequence:CCGGGCATGTTAAGTAGATATTATCCTCGAGGATAATATCTACTTAACATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013488    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004289.5-2452s1c1
Sequence:CCGGGCTACTTGAATAACTCAGTTACTCGAGTAACTGAGTTATTCAAGTAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004289.5-1330s1c1
Sequence:CCGGTGGAACTAATTTGACAGGATTCTCGAGAATCCTGTCAAATTAGTTCCATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004289.5-2225s1c1
Sequence:CCGGCCAGTCAATCCCAACCACTATCTCGAGATAGTGGTTGGGATTGACTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004289.5-1853s1c1
Sequence:CCGGGATAGAAACTTGAGCCGTGATCTCGAGATCACGGCTCAAGTTTCTATCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013490    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004289.5-1046s1c1
Sequence:CCGGGAAGACTTATTCCAGTTGCTTCTCGAGAAGCAACTGGAATAAGTCTTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010903
NFE2L3 MISSION shRNA Bacterial Glycerol Stock
nuclear factor, erythroid 2-like 3
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000232252    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010903.1-1440s21c1
Sequence:CCGGCACAAATTCTTACCGTATTTACTCGAGTAAATACGGTAAGAATTTGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232256    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010903.1-2274s21c1
Sequence:CCGGGTACTGGTACTTGAATCATTCCTCGAGGAATGATTCAAGTACCAGTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232255    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010903.1-1851s21c1
Sequence:CCGGAGTGTCTCTCATCCGTGATATCTCGAGATATCACGGATGAGAGACACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232254    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010903.1-1615s21c1
Sequence:CCGGCATGACCACACTTACCATTTACTCGAGTAAATGGTAAGTGTGGTCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232253    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010903.1-1492s21c1
Sequence:CCGGCAGTCTCTTTGTCATGATTTACTCGAGTAAATCATGACAAAGAGACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082133    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010903.1-2327s1c1
Sequence:CCGGGCTTCTGTGAAGTTGGGAGAACTCGAGTTCTCCCAACTTCACAGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082136    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010903.1-1200s1c1
Sequence:CCGGGCAGTTAAATCCTCATACAAACTCGAGTTTGTATGAGGATTTAACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082135    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010903.1-1735s1c1
Sequence:CCGGCGTGATGAACAGCGTGCTAAACTCGAGTTTAGCACGCTGTTCATCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082134    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010903.1-923s1c1
Sequence:CCGGGCCATCTACATTGGTCAGATACTCGAGTATCTGACCAATGTAGATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010903.1-276s1c1
Sequence:CCGGCCTGCAACTCACGATTCTGTTCTCGAGAACAGAATCGTGAGTTGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010903
NFE2L3 MISSION shRNA shRNA Plasmid DNA
nuclear factor, erythroid 2-like 3
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000232252    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010903.1-1440s21c1
Sequence:CCGGCACAAATTCTTACCGTATTTACTCGAGTAAATACGGTAAGAATTTGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232256    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010903.1-2274s21c1
Sequence:CCGGGTACTGGTACTTGAATCATTCCTCGAGGAATGATTCAAGTACCAGTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232255    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010903.1-1851s21c1
Sequence:CCGGAGTGTCTCTCATCCGTGATATCTCGAGATATCACGGATGAGAGACACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232254    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010903.1-1615s21c1
Sequence:CCGGCATGACCACACTTACCATTTACTCGAGTAAATGGTAAGTGTGGTCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232253    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010903.1-1492s21c1
Sequence:CCGGCAGTCTCTTTGTCATGATTTACTCGAGTAAATCATGACAAAGAGACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082133    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010903.1-2327s1c1
Sequence:CCGGGCTTCTGTGAAGTTGGGAGAACTCGAGTTCTCCCAACTTCACAGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082136    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010903.1-1200s1c1
Sequence:CCGGGCAGTTAAATCCTCATACAAACTCGAGTTTGTATGAGGATTTAACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082135    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010903.1-1735s1c1
Sequence:CCGGCGTGATGAACAGCGTGCTAAACTCGAGTTTAGCACGCTGTTCATCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082134    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010903.1-923s1c1
Sequence:CCGGGCCATCTACATTGGTCAGATACTCGAGTATCTGACCAATGTAGATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010903.1-276s1c1
Sequence:CCGGCCTGCAACTCACGATTCTGTTCTCGAGAACAGAATCGTGAGTTGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010903
NFE2L3 MISSION shRNA Lentiviral Transduction Particles
nuclear factor, erythroid 2-like 3
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000232252    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010903.1-1440s21c1
Sequence:CCGGCACAAATTCTTACCGTATTTACTCGAGTAAATACGGTAAGAATTTGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232256    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010903.1-2274s21c1
Sequence:CCGGGTACTGGTACTTGAATCATTCCTCGAGGAATGATTCAAGTACCAGTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232255    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010903.1-1851s21c1
Sequence:CCGGAGTGTCTCTCATCCGTGATATCTCGAGATATCACGGATGAGAGACACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232254    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010903.1-1615s21c1
Sequence:CCGGCATGACCACACTTACCATTTACTCGAGTAAATGGTAAGTGTGGTCATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232253    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010903.1-1492s21c1
Sequence:CCGGCAGTCTCTTTGTCATGATTTACTCGAGTAAATCATGACAAAGAGACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082133    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010903.1-2327s1c1
Sequence:CCGGGCTTCTGTGAAGTTGGGAGAACTCGAGTTCTCCCAACTTCACAGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082136    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010903.1-1200s1c1
Sequence:CCGGGCAGTTAAATCCTCATACAAACTCGAGTTTGTATGAGGATTTAACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082135    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010903.1-1735s1c1
Sequence:CCGGCGTGATGAACAGCGTGCTAAACTCGAGTTTAGCACGCTGTTCATCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082134    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010903.1-923s1c1
Sequence:CCGGGCCATCTACATTGGTCAGATACTCGAGTATCTGACCAATGTAGATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010903.1-276s1c1
Sequence:CCGGCCTGCAACTCACGATTCTGTTCTCGAGAACAGAATCGTGAGTTGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)