EMAIL THIS PAGE TO A FRIEND

NFE4

nuclear factor, erythroid 4

2 Gene Product Result for
Synonyms: NF-E4
Species: Human NFE4(58160)
UniProtKB ID: Q86UQ8
Gene ID:
Human(58160) Summary: The erythroid-specific protein encoded by this gene, and the ubiquitous transcription factor CP2, form the stage selector protein (SSP) complex, which is involved in preferential expression of the gamma-globin genes in fetal erythroid cells. Alternate use of an in-frame upstream non-AUG (CUG) translation initiation codon, and a downstream AUG codon, results in two isoforms. While the long isoform (22 kDa) acts as an activator, the short isoform (14 kDa) has been shown to repress gamma-globin gene expression. This gene is located in an intron of the FBXL13 gene on the opposite strand. [provided by RefSeq, Jul 2008]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001085386 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001085386 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001085386 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001085386
NFE4 MISSION shRNA Bacterial Glycerol Stock
nuclear factor, erythroid 4
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000263142    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085386.1-585s21c1
Sequence:CCGGCTTGCCGCTGAAGACTGATAGCTCGAGCTATCAGTCTTCAGCGGCAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263146    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085386.1-626s21c1
Sequence:CCGGAGCAACTACCATCGCTTCATCCTCGAGGATGAAGCGATGGTAGTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263145    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001085386.1-710s21c1
Sequence:CCGGCAGTGTGAGTCAGCAAGATAGCTCGAGCTATCTTGCTGACTCACACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263143    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085386.1-155s21c1
Sequence:CCGGGTTTGAACGGATACAAGAATCCTCGAGGATTCTTGTATCCGTTCAAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263144    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085386.1-541s21c1
Sequence:CCGGCCCTTCCTGAGCCAATCAAACCTCGAGGTTTGATTGGCTCAGGAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001085386
NFE4 MISSION shRNA shRNA Plasmid DNA
nuclear factor, erythroid 4
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000263142    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085386.1-585s21c1
Sequence:CCGGCTTGCCGCTGAAGACTGATAGCTCGAGCTATCAGTCTTCAGCGGCAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000263146    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085386.1-626s21c1
Sequence:CCGGAGCAACTACCATCGCTTCATCCTCGAGGATGAAGCGATGGTAGTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000263145    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001085386.1-710s21c1
Sequence:CCGGCAGTGTGAGTCAGCAAGATAGCTCGAGCTATCTTGCTGACTCACACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000263143    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085386.1-155s21c1
Sequence:CCGGGTTTGAACGGATACAAGAATCCTCGAGGATTCTTGTATCCGTTCAAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000263144    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085386.1-541s21c1
Sequence:CCGGCCCTTCCTGAGCCAATCAAACCTCGAGGTTTGATTGGCTCAGGAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001085386
NFE4 MISSION shRNA Lentiviral Transduction Particles
nuclear factor, erythroid 4
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000263142    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085386.1-585s21c1
Sequence:CCGGCTTGCCGCTGAAGACTGATAGCTCGAGCTATCAGTCTTCAGCGGCAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263146    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085386.1-626s21c1
Sequence:CCGGAGCAACTACCATCGCTTCATCCTCGAGGATGAAGCGATGGTAGTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263145    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001085386.1-710s21c1
Sequence:CCGGCAGTGTGAGTCAGCAAGATAGCTCGAGCTATCTTGCTGACTCACACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263143    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085386.1-155s21c1
Sequence:CCGGGTTTGAACGGATACAAGAATCCTCGAGGATTCTTGTATCCGTTCAAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263144    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085386.1-541s21c1
Sequence:CCGGCCCTTCCTGAGCCAATCAAACCTCGAGGTTTGATTGGCTCAGGAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)