EMAIL THIS PAGE TO A FRIEND

NFIA

nuclear factor I/A

156 Gene Product Result for
Synonyms: CTF NF-I/A NF1-A NFI-A NFI-L
Gene ID:
Human(4774) Summary: This gene encodes a member of the NF1 (nuclear factor 1) family of transcription factors. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2011]
Mouse(18027) nuclear factor I/A
Rat(25492) nuclear factor I/A
Zebrafish(556665) nuclear factor I/A
domestic cat(101101400) nuclear factor I/A
cow(615371) nuclear factor I/A
dog(479552) nuclear factor I/A
chicken(396210) nuclear factor I/A
sheep(101105452) nuclear factor I/A
naked mole-rat(101721781) nuclear factor I/A
domestic guinea pig(100730791) nuclear factor I/A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010905 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010905 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010905 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005595 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005595 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005595 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005595 Rosetta Predictions human pricing
NM_012988 Rosetta Predictions rat pricing
XM_579362 Rosetta Predictions rat pricing
NM_001122952 Rosetta Predictions mouse pricing
NM_001122953 Rosetta Predictions mouse pricing
NM_010905 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005595 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00186285 predicted 679
2 SASI_Hs01_00186286 predicted 793
3 SASI_Hs01_00186287 predicted 912
4 SASI_Hs01_00186288 predicted 585
5 SASI_Hs01_00186289 predicted 846
6 SASI_Hs01_00186290 predicted 1356
7 SASI_Hs01_00186292 predicted 1097
8 SASI_Hs01_00186293 predicted 1346
9 SASI_Hs02_00339905 predicted 503
10 SASI_Hs01_00186294 predicted 771
11 SASI_Hs01_00186291 predicted 727
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012988 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00094240 predicted 481
2 SASI_Rn01_00094241 predicted 778
3 SASI_Rn01_00094242 predicted 896
4 SASI_Rn01_00094243 predicted 386
5 SASI_Rn02_00260622 predicted 679
6 SASI_Rn01_00094245 predicted 710
7 SASI_Rn01_00094246 predicted 832
8 SASI_Rn01_00094247 predicted 988
9 SASI_Rn01_00094248 predicted 741
10 SASI_Rn01_00094249 predicted 665
11 SASI_Rn01_00094244 predicted 402
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579362 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00170469 predicted 314
2 SASI_Rn01_00170470 predicted 315
3 SASI_Rn01_00170471 predicted 275
4 SASI_Rn01_00170472 predicted 221
5 SASI_Rn01_00170473 predicted 227
6 SASI_Rn01_00170474 predicted 203
7 SASI_Rn01_00170475 predicted 250
8 SASI_Rn01_00170476 predicted 231
9 SASI_Rn01_00170477 predicted 253
10 SASI_Rn01_00170478 predicted 233
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001122952 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00309629 predicted 685
2 SASI_Mm02_00309630 predicted 437
3 SASI_Mm02_00309631 predicted 1458
4 SASI_Mm02_00309632 predicted 332
5 SASI_Mm02_00309633 predicted 765
6 SASI_Mm02_00309634 predicted 628
7 SASI_Mm02_00309635 predicted 516
8 SASI_Mm02_00309636 predicted 652
9 SASI_Mm02_00309637 predicted 1583
10 SASI_Mm02_00309638 predicted 778
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001122953 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00309639 predicted 920
2 SASI_Mm02_00309640 predicted 676
3 SASI_Mm02_00309641 predicted 1571
4 SASI_Mm02_00309642 predicted 580
5 SASI_Mm02_00309643 predicted 1007
6 SASI_Mm02_00309644 predicted 859
7 SASI_Mm02_00309645 predicted 751
8 SASI_Mm02_00309646 predicted 895
9 SASI_Mm02_00309647 predicted 1695
10 SASI_Mm02_00309648 predicted 1022
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010905 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00319627 predicted 922
2 SASI_Mm01_00198578 predicted 672
3 SASI_Mm02_00319628 predicted 1704
4 SASI_Mm01_00198579 predicted 573
5 SASI_Mm02_00319629 predicted 1004
6 SASI_Mm01_00198581 predicted 862
7 SASI_Mm01_00198582 predicted 752
8 SASI_Mm02_00319630 predicted 899
9 SASI_Mm02_00319631 predicted 1822
10 SASI_Mm01_00198583 predicted 1014
11 SASI_Mm01_00198580 predicted 823
12 SASI_Mm01_00198584 predicted 1264
13 SASI_Mm01_00198585 predicted 1269
14 SASI_Mm01_00198586 predicted 581
15 SASI_Mm01_00198587 predicted 443
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010905
VALIDATED
NFIA MISSION shRNA Bacterial Glycerol Stock
nuclear factor I/A
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000321221    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010905.3-855s21c1
Sequence:CCGGTGTAAAGGAACTCGATTTATACTCGAGTATAAATCGAGTTCCTTTACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281996    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010905.3-1011s21c1
Sequence:CCGGCAGTGTGACTGAGCTAGTAAGCTCGAGCTTACTAGCTCAGTCACACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273729    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010905.3-663s21c1
Sequence:CCGGCCCTGATCAGAAAGGCAAGATCTCGAGATCTTGCCTTTCTGATCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010905.1-110s1c1
Sequence:CCGGCATCCTTTCATTGAAGCACTTCTCGAGAAGTGCTTCAATGAAAGGATGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012087    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010905.1-807s1c1
Sequence:CCGGCTCTCTCTGATTTGGAAAGTTCTCGAGAACTTTCCAAATCAGAGAGAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010905.1-1520s1c1
Sequence:CCGGGCAAACCGATTCGTCAGTGTTCTCGAGAACACTGACGAATCGGTTTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012085    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010905.1-394s1c1
Sequence:CCGGCCCTGATCAGAAAGGCAAGATCTCGAGATCTTGCCTTTCTGATCAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321160    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010905.3-777s21c1
Sequence:CCGGTGATGGCGAGCGCCTTGTAAACTCGAGTTTACAAGGCGCTCGCCATCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273730    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010905.3-2118s21c1
Sequence:CCGGCTTTAGGGACTGTCGTAATTTCTCGAGAAATTACGACAGTCCCTAAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010905
VALIDATED
NFIA MISSION shRNA shRNA Plasmid DNA
nuclear factor I/A
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000321221    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010905.3-855s21c1
Sequence:CCGGTGTAAAGGAACTCGATTTATACTCGAGTATAAATCGAGTTCCTTTACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000281996    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010905.3-1011s21c1
Sequence:CCGGCAGTGTGACTGAGCTAGTAAGCTCGAGCTTACTAGCTCAGTCACACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273729    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010905.3-663s21c1
Sequence:CCGGCCCTGATCAGAAAGGCAAGATCTCGAGATCTTGCCTTTCTGATCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010905.1-110s1c1
Sequence:CCGGCATCCTTTCATTGAAGCACTTCTCGAGAAGTGCTTCAATGAAAGGATGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012087    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010905.1-807s1c1
Sequence:CCGGCTCTCTCTGATTTGGAAAGTTCTCGAGAACTTTCCAAATCAGAGAGAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010905.1-1520s1c1
Sequence:CCGGGCAAACCGATTCGTCAGTGTTCTCGAGAACACTGACGAATCGGTTTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012085    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010905.1-394s1c1
Sequence:CCGGCCCTGATCAGAAAGGCAAGATCTCGAGATCTTGCCTTTCTGATCAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000321160    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010905.3-777s21c1
Sequence:CCGGTGATGGCGAGCGCCTTGTAAACTCGAGTTTACAAGGCGCTCGCCATCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273730    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010905.3-2118s21c1
Sequence:CCGGCTTTAGGGACTGTCGTAATTTCTCGAGAAATTACGACAGTCCCTAAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010905
VALIDATED
NFIA MISSION shRNA Lentiviral Transduction Particles
nuclear factor I/A
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000321221    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010905.3-855s21c1
Sequence:CCGGTGTAAAGGAACTCGATTTATACTCGAGTATAAATCGAGTTCCTTTACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281996    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010905.3-1011s21c1
Sequence:CCGGCAGTGTGACTGAGCTAGTAAGCTCGAGCTTACTAGCTCAGTCACACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273729    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010905.3-663s21c1
Sequence:CCGGCCCTGATCAGAAAGGCAAGATCTCGAGATCTTGCCTTTCTGATCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010905.1-110s1c1
Sequence:CCGGCATCCTTTCATTGAAGCACTTCTCGAGAAGTGCTTCAATGAAAGGATGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012087    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010905.1-807s1c1
Sequence:CCGGCTCTCTCTGATTTGGAAAGTTCTCGAGAACTTTCCAAATCAGAGAGAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010905.1-1520s1c1
Sequence:CCGGGCAAACCGATTCGTCAGTGTTCTCGAGAACACTGACGAATCGGTTTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012085    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010905.1-394s1c1
Sequence:CCGGCCCTGATCAGAAAGGCAAGATCTCGAGATCTTGCCTTTCTGATCAGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321160    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010905.3-777s21c1
Sequence:CCGGTGATGGCGAGCGCCTTGTAAACTCGAGTTTACAAGGCGCTCGCCATCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273730    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010905.3-2118s21c1
Sequence:CCGGCTTTAGGGACTGTCGTAATTTCTCGAGAAATTACGACAGTCCCTAAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005595
VALIDATED
NFIA MISSION shRNA Bacterial Glycerol Stock
nuclear factor I/A
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000229662    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_005595.1-949s21c1
Sequence:CCGGGGAGCAATGAGGAGGTCTTTACTCGAGTAAAGACCTCCTCATTGCTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005595.1-683s1c1
Sequence:CCGGCTGTTAAGGAACTCGATTTATCTCGAGATAAATCGAGTTCCTTAACAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016228    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005595.1-1690s1c1
Sequence:CCGGGCGCAGTTACAACTTCACTATCTCGAGATAGTGAAGTTGTAACTGCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016232    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005595.1-1143s1c1
Sequence:CCGGGAAGTCGGAGAAGTCTGGTTTCTCGAGAAACCAGACTTCTCCGACTTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016229    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005595.1-334s1c1
Sequence:CCGGGCCGTGAAGGATGAATTGCTACTCGAGTAGCAATTCATCCTTCACGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229663    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_005595.1-1279s21c1
Sequence:CCGGTTCCCGACATCACCCATTATCCTCGAGGATAATGGGTGATGTCGGGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016230    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005595.1-422s1c1
Sequence:CCGGGACCCGAATATCGAGAGGATTCTCGAGAATCCTCTCGATATTCGGGTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229660    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_005595.1-683s21c1
Sequence:CCGGCTGTTAAGGAACTCGATTTATCTCGAGATAAATCGAGTTCCTTAACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229661    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_005595.1-882s21c1
Sequence:CCGGTGCAGGAACTGGCCCAAATTTCTCGAGAAATTTGGGCCAGTTCCTGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218979    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_005595.1-2074s21c1
Sequence:GTACCGGGTAGCTGAGATCTGCAATATACTCGAGTATATTGCAGATCTCAGCTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005595
VALIDATED
NFIA MISSION shRNA shRNA Plasmid DNA
nuclear factor I/A
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000229662    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_005595.1-949s21c1
Sequence:CCGGGGAGCAATGAGGAGGTCTTTACTCGAGTAAAGACCTCCTCATTGCTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005595.1-683s1c1
Sequence:CCGGCTGTTAAGGAACTCGATTTATCTCGAGATAAATCGAGTTCCTTAACAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016228    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005595.1-1690s1c1
Sequence:CCGGGCGCAGTTACAACTTCACTATCTCGAGATAGTGAAGTTGTAACTGCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016232    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005595.1-1143s1c1
Sequence:CCGGGAAGTCGGAGAAGTCTGGTTTCTCGAGAAACCAGACTTCTCCGACTTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016229    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005595.1-334s1c1
Sequence:CCGGGCCGTGAAGGATGAATTGCTACTCGAGTAGCAATTCATCCTTCACGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000229663    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_005595.1-1279s21c1
Sequence:CCGGTTCCCGACATCACCCATTATCCTCGAGGATAATGGGTGATGTCGGGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016230    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005595.1-422s1c1
Sequence:CCGGGACCCGAATATCGAGAGGATTCTCGAGAATCCTCTCGATATTCGGGTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000229660    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_005595.1-683s21c1
Sequence:CCGGCTGTTAAGGAACTCGATTTATCTCGAGATAAATCGAGTTCCTTAACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000229661    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_005595.1-882s21c1
Sequence:CCGGTGCAGGAACTGGCCCAAATTTCTCGAGAAATTTGGGCCAGTTCCTGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218979    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_005595.1-2074s21c1
Sequence:GTACCGGGTAGCTGAGATCTGCAATATACTCGAGTATATTGCAGATCTCAGCTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005595
VALIDATED
NFIA MISSION shRNA Lentiviral Transduction Particles
nuclear factor I/A
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000229662    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_005595.1-949s21c1
Sequence:CCGGGGAGCAATGAGGAGGTCTTTACTCGAGTAAAGACCTCCTCATTGCTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005595.1-683s1c1
Sequence:CCGGCTGTTAAGGAACTCGATTTATCTCGAGATAAATCGAGTTCCTTAACAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016228    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005595.1-1690s1c1
Sequence:CCGGGCGCAGTTACAACTTCACTATCTCGAGATAGTGAAGTTGTAACTGCGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016232    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005595.1-1143s1c1
Sequence:CCGGGAAGTCGGAGAAGTCTGGTTTCTCGAGAAACCAGACTTCTCCGACTTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016229    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005595.1-334s1c1
Sequence:CCGGGCCGTGAAGGATGAATTGCTACTCGAGTAGCAATTCATCCTTCACGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229663    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_005595.1-1279s21c1
Sequence:CCGGTTCCCGACATCACCCATTATCCTCGAGGATAATGGGTGATGTCGGGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016230    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005595.1-422s1c1
Sequence:CCGGGACCCGAATATCGAGAGGATTCTCGAGAATCCTCTCGATATTCGGGTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229660    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_005595.1-683s21c1
Sequence:CCGGCTGTTAAGGAACTCGATTTATCTCGAGATAAATCGAGTTCCTTAACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229661    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_005595.1-882s21c1
Sequence:CCGGTGCAGGAACTGGCCCAAATTTCTCGAGAAATTTGGGCCAGTTCCTGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218979    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_005595.1-2074s21c1
Sequence:GTACCGGGTAGCTGAGATCTGCAATATACTCGAGTATATTGCAGATCTCAGCTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)