EMAIL THIS PAGE TO A FRIEND

NFIB

nuclear factor I/B

401 Gene Product Result for
Synonyms: CTF HMGIC/NFIB NF-I/B NF1-B NFI-B NFI-RED NFIB2 NFIB3
Gene ID:
Mouse(18028) nuclear factor I/B
Rat(29227) nuclear factor I/B
domestic guinea pig(100724581) nuclear factor I/B
naked mole-rat(101708254) nuclear factor I/B
sheep(100913158) nuclear factor I/B
chicken(396209) nuclear factor I/B
cow(538474) nuclear factor I/B
domestic cat(101101422) nuclear factor I/B
dog(474709) nuclear factor I/B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005596 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005596 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005596 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008687 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008687 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008687 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005596 Rosetta Predictions human pricing
NM_031566 Rosetta Predictions rat pricing
NM_001113209 Rosetta Predictions mouse pricing
NM_001113210 Rosetta Predictions mouse pricing
NM_008687 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005596 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00226371 predicted 705
2 SASI_Hs01_00226372 predicted 805
3 SASI_Hs01_00226373 predicted 1351
4 SASI_Hs01_00226374 predicted 1035
5 SASI_Hs01_00226375 predicted 1609
6 SASI_Hs01_00226376 predicted 1355
7 SASI_Hs01_00226377 predicted 1081
8 SASI_Hs01_00226378 predicted 991
9 SASI_Hs01_00226379 predicted 936
10 SASI_Hs02_00339906 predicted 675
11 SASI_Hs01_00226370 predicted 1087
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031566 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00264790 predicted 500
2 SASI_Rn02_00264791 predicted 923
3 SASI_Rn02_00264792 predicted 366
4 SASI_Rn02_00264793 predicted 654
5 SASI_Rn02_00264794 predicted 736
6 SASI_Rn02_00264795 predicted 1191
7 SASI_Rn02_00264796 predicted 1409
8 SASI_Rn02_00264797 predicted 1399
9 SASI_Rn02_00264798 predicted 1352
10 SASI_Rn02_00264799 predicted 1172
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001113209 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00307243 predicted 1469
2 SASI_Mm02_00307244 predicted 1061
3 SASI_Mm02_00307245 predicted 812
4 SASI_Mm02_00307246 predicted 1297
5 SASI_Mm02_00307247 predicted 2354
6 SASI_Mm02_00307248 predicted 1287
7 SASI_Mm02_00307249 predicted 914
8 SASI_Mm02_00307250 predicted 572
9 SASI_Mm02_00307251 predicted 678
10 SASI_Mm02_00307252 predicted 584
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001113210 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00307253 predicted 1463
2 SASI_Mm02_00307254 predicted 1055
3 SASI_Mm02_00307255 predicted 818
4 SASI_Mm02_00307256 predicted 1293
5 SASI_Mm02_00307257 predicted 2326
6 SASI_Mm02_00307258 predicted 1281
7 SASI_Mm02_00307259 predicted 915
8 SASI_Mm02_00307260 predicted 574
9 SASI_Mm02_00307261 predicted 685
10 SASI_Mm02_00307262 predicted 585
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008687 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00314486 predicted 1467
2 SASI_Mm01_00176417 predicted 1056
3 SASI_Mm02_00314487 predicted 817
4 SASI_Mm02_00314488 predicted 1301
5 SASI_Mm01_00176419 predicted 1282
6 SASI_Mm01_00176420 predicted 917
7 SASI_Mm02_00314489 predicted 577
8 SASI_Mm02_00314490 predicted 679
9 SASI_Mm02_00314491 predicted 583
10 SASI_Mm02_00314492 predicted 1252
11 SASI_Mm01_00176416 predicted 1558
12 SASI_Mm01_00176418 predicted 1286
13 SASI_Mm01_00176421 predicted 1468
14 SASI_Mm01_00176422 predicted 1566
15 SASI_Mm01_00176423 predicted 1542
16 SASI_Mm01_00176424 predicted 1525
17 SASI_Mm01_00176425 predicted 394
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005596
VALIDATED
NFIB MISSION shRNA Bacterial Glycerol Stock
nuclear factor I/B
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000014678    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_005596.1-1967s1c1
Sequence:CCGGCCTGGTTATCTCACCAACGAACTCGAGTTCGTTGGTGAGATAACCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014680    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_005596.1-513s1c1
Sequence:CCGGCCGTGCTGTGTCTTATCCAATCTCGAGATTGGATAAGACACAGCACGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014679    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_005596.1-1302s1c1
Sequence:CCGGCCGTTGCCATTTCCAACACAACTCGAGTTGTGTTGGAAATGGCAACGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014681    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_005596.1-1118s1c1
Sequence:CCGGGCACGAAAGAGATCAAGATATCTCGAGATATCTTGATCTCTTTCGTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014682    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005596.1-249s1c1
Sequence:CCGGCACCCATTCATGGAAGCACTTCTCGAGAAGTGCTTCCATGAATGGGTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274124    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_005596.2-1946s21c1
Sequence:CCGGGCAGCACTTACAATCACTAATCTCGAGATTAGTGATTGTAAGTGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274063    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_005596.2-936s21c1
Sequence:CCGGTCATATCACAGTATCAGTTAACTCGAGTTAACTGATACTGTGATATGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274065    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_005596.2-739s21c1
Sequence:CCGGCCGTGCTGTGTCTTATCCAATCTCGAGATTGGATAAGACACAGCACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274067    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_005596.2-1528s21c1
Sequence:CCGGCCGTTGCCATTTCCAACACAACTCGAGTTGTGTTGGAAATGGCAACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274066    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_005596.2-1344s21c1
Sequence:CCGGGCACGAAAGAGATCAAGATATCTCGAGATATCTTGATCTCTTTCGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005596
VALIDATED
NFIB MISSION shRNA shRNA Plasmid DNA
nuclear factor I/B
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000014678    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_005596.1-1967s1c1
Sequence:CCGGCCTGGTTATCTCACCAACGAACTCGAGTTCGTTGGTGAGATAACCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014680    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_005596.1-513s1c1
Sequence:CCGGCCGTGCTGTGTCTTATCCAATCTCGAGATTGGATAAGACACAGCACGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014679    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_005596.1-1302s1c1
Sequence:CCGGCCGTTGCCATTTCCAACACAACTCGAGTTGTGTTGGAAATGGCAACGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014681    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_005596.1-1118s1c1
Sequence:CCGGGCACGAAAGAGATCAAGATATCTCGAGATATCTTGATCTCTTTCGTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014682    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005596.1-249s1c1
Sequence:CCGGCACCCATTCATGGAAGCACTTCTCGAGAAGTGCTTCCATGAATGGGTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274124    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_005596.2-1946s21c1
Sequence:CCGGGCAGCACTTACAATCACTAATCTCGAGATTAGTGATTGTAAGTGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274063    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_005596.2-936s21c1
Sequence:CCGGTCATATCACAGTATCAGTTAACTCGAGTTAACTGATACTGTGATATGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274065    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_005596.2-739s21c1
Sequence:CCGGCCGTGCTGTGTCTTATCCAATCTCGAGATTGGATAAGACACAGCACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274067    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_005596.2-1528s21c1
Sequence:CCGGCCGTTGCCATTTCCAACACAACTCGAGTTGTGTTGGAAATGGCAACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274066    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_005596.2-1344s21c1
Sequence:CCGGGCACGAAAGAGATCAAGATATCTCGAGATATCTTGATCTCTTTCGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005596
VALIDATED
NFIB MISSION shRNA Lentiviral Transduction Particles
nuclear factor I/B
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000014678    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_005596.1-1967s1c1
Sequence:CCGGCCTGGTTATCTCACCAACGAACTCGAGTTCGTTGGTGAGATAACCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014680    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_005596.1-513s1c1
Sequence:CCGGCCGTGCTGTGTCTTATCCAATCTCGAGATTGGATAAGACACAGCACGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014679    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_005596.1-1302s1c1
Sequence:CCGGCCGTTGCCATTTCCAACACAACTCGAGTTGTGTTGGAAATGGCAACGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014681    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_005596.1-1118s1c1
Sequence:CCGGGCACGAAAGAGATCAAGATATCTCGAGATATCTTGATCTCTTTCGTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014682    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005596.1-249s1c1
Sequence:CCGGCACCCATTCATGGAAGCACTTCTCGAGAAGTGCTTCCATGAATGGGTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274124    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_005596.2-1946s21c1
Sequence:CCGGGCAGCACTTACAATCACTAATCTCGAGATTAGTGATTGTAAGTGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274063    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_005596.2-936s21c1
Sequence:CCGGTCATATCACAGTATCAGTTAACTCGAGTTAACTGATACTGTGATATGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274065    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_005596.2-739s21c1
Sequence:CCGGCCGTGCTGTGTCTTATCCAATCTCGAGATTGGATAAGACACAGCACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274067    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_005596.2-1528s21c1
Sequence:CCGGCCGTTGCCATTTCCAACACAACTCGAGTTGTGTTGGAAATGGCAACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274066    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_005596.2-1344s21c1
Sequence:CCGGGCACGAAAGAGATCAAGATATCTCGAGATATCTTGATCTCTTTCGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008687
VALIDATED
NFIB MISSION shRNA Bacterial Glycerol Stock
nuclear factor I/B
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000012092    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008687.2-1102s1c1
Sequence:CCGGCCAACCATACTATCATGACATCTCGAGATGTCATGATAGTATGGTTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012091    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008687.2-772s1c1
Sequence:CCGGCCTGTTCAAAGGCATCCCTTTCTCGAGAAAGGGATGCCTTTGAACAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012090    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008687.2-1496s1c1
Sequence:CCGGCCTTCCAGCTACTTCTCTCATCTCGAGATGAGAGAAGTAGCTGGAAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012089    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008687.2-407s1c1
Sequence:CCGGCCATTTATTGAGGCACTTCTTCTCGAGAAGAAGTGCCTCAATAAATGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012088    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008687.2-1750s1c1
Sequence:CCGGCCACAACCATAGTATAAGAAACTCGAGTTTCTTATACTATGGTTGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273781    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008687.5-1934s21c1
Sequence:CCGGCCACAACCATAGTATAAGAAACTCGAGTTTCTTATACTATGGTTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273732    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008687.5-874s21c1
Sequence:CCGGCAGACCAGAAGGGTAAGATTACTCGAGTAATCTTACCCTTCTGGTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273731    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008687.5-1049s21c1
Sequence:CCGGCCACATCACAGTATCAGTTAACTCGAGTTAACTGATACTGTGATGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273782    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008687.5-616s21c1
Sequence:CCGGACGTCCGTGCAATTGCCTATACTCGAGTATAGGCAATTGCACGGACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273780    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008687.5-1259s21c1
Sequence:CCGGCAACTTCCCAATCGGAGAAATCTCGAGATTTCTCCGATTGGGAAGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008687
VALIDATED
NFIB MISSION shRNA shRNA Plasmid DNA
nuclear factor I/B
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000012092    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008687.2-1102s1c1
Sequence:CCGGCCAACCATACTATCATGACATCTCGAGATGTCATGATAGTATGGTTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012091    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008687.2-772s1c1
Sequence:CCGGCCTGTTCAAAGGCATCCCTTTCTCGAGAAAGGGATGCCTTTGAACAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012090    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008687.2-1496s1c1
Sequence:CCGGCCTTCCAGCTACTTCTCTCATCTCGAGATGAGAGAAGTAGCTGGAAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012089    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008687.2-407s1c1
Sequence:CCGGCCATTTATTGAGGCACTTCTTCTCGAGAAGAAGTGCCTCAATAAATGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012088    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008687.2-1750s1c1
Sequence:CCGGCCACAACCATAGTATAAGAAACTCGAGTTTCTTATACTATGGTTGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273781    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008687.5-1934s21c1
Sequence:CCGGCCACAACCATAGTATAAGAAACTCGAGTTTCTTATACTATGGTTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273732    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008687.5-874s21c1
Sequence:CCGGCAGACCAGAAGGGTAAGATTACTCGAGTAATCTTACCCTTCTGGTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273731    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008687.5-1049s21c1
Sequence:CCGGCCACATCACAGTATCAGTTAACTCGAGTTAACTGATACTGTGATGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273782    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008687.5-616s21c1
Sequence:CCGGACGTCCGTGCAATTGCCTATACTCGAGTATAGGCAATTGCACGGACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273780    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008687.5-1259s21c1
Sequence:CCGGCAACTTCCCAATCGGAGAAATCTCGAGATTTCTCCGATTGGGAAGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008687
VALIDATED
NFIB MISSION shRNA Lentiviral Transduction Particles
nuclear factor I/B
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000012092    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008687.2-1102s1c1
Sequence:CCGGCCAACCATACTATCATGACATCTCGAGATGTCATGATAGTATGGTTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012091    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008687.2-772s1c1
Sequence:CCGGCCTGTTCAAAGGCATCCCTTTCTCGAGAAAGGGATGCCTTTGAACAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012090    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008687.2-1496s1c1
Sequence:CCGGCCTTCCAGCTACTTCTCTCATCTCGAGATGAGAGAAGTAGCTGGAAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012089    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008687.2-407s1c1
Sequence:CCGGCCATTTATTGAGGCACTTCTTCTCGAGAAGAAGTGCCTCAATAAATGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012088    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008687.2-1750s1c1
Sequence:CCGGCCACAACCATAGTATAAGAAACTCGAGTTTCTTATACTATGGTTGTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273781    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008687.5-1934s21c1
Sequence:CCGGCCACAACCATAGTATAAGAAACTCGAGTTTCTTATACTATGGTTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273732    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008687.5-874s21c1
Sequence:CCGGCAGACCAGAAGGGTAAGATTACTCGAGTAATCTTACCCTTCTGGTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273731    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008687.5-1049s21c1
Sequence:CCGGCCACATCACAGTATCAGTTAACTCGAGTTAACTGATACTGTGATGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273782    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008687.5-616s21c1
Sequence:CCGGACGTCCGTGCAATTGCCTATACTCGAGTATAGGCAATTGCACGGACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273780    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008687.5-1259s21c1
Sequence:CCGGCAACTTCCCAATCGGAGAAATCTCGAGATTTCTCCGATTGGGAAGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)