EMAIL THIS PAGE TO A FRIEND

NFIC

nuclear factor I/C (CCAAT-binding transcription factor)

70 Gene Product Result for
Synonyms: CTF CTF5 NF-I NFI
Gene ID:
Human(4782) Summary: The protein encoded by this gene belongs to the CTF/NF-I family. These are dimeric DNA-binding proteins, and function as cellular transcription factors and as replication factors for adenovirus DNA replication. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Oct 2011]
Mouse(18029) nuclear factor I/C
Rat(29228) nuclear factor I/C
chicken(396208) nuclear factor I/C (CCAAT-binding transcription factor)
cow(553098) nuclear factor I/C (CCAAT-binding transcription factor)
domestic cat(101087560) nuclear factor I/C (CCAAT-binding transcription factor)
dog(485061) nuclear factor I/C (CCAAT-binding transcription factor)
sheep(101118187) nuclear factor I/C (CCAAT-binding transcription factor)
naked mole-rat(101716128) nuclear factor I/C (CCAAT-binding transcription factor)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008688 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008688 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008688 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005597 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005597 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005597 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005597 Rosetta Predictions human pricing
NM_205843 Rosetta Predictions human pricing
NM_031567 Rosetta Predictions rat pricing
NM_008688 Rosetta Predictions mouse pricing
NM_026756 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005597 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00048020 predicted 569
2 SASI_Hs01_00048021 predicted 601
3 SASI_Hs01_00048022 predicted 726
4 SASI_Hs01_00048023 predicted 746
5 SASI_Hs01_00048024 predicted 390
6 SASI_Hs01_00048025 predicted 903
7 SASI_Hs01_00048026 predicted 695
8 SASI_Hs01_00048027 predicted 680
9 SASI_Hs01_00048028 predicted 563
10 SASI_Hs01_00048029 predicted 332
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_205843 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00051014 predicted 545
2 SASI_Hs01_00051015 predicted 576
3 SASI_Hs01_00051016 predicted 708
4 SASI_Hs01_00051017 predicted 723
5 SASI_Hs01_00051018 predicted 369
6 SASI_Hs01_00051019 predicted 870
7 SASI_Hs01_00051020 predicted 673
8 SASI_Hs01_00051021 predicted 659
9 SASI_Hs01_00051022 predicted 536
10 SASI_Hs01_00051023 predicted 305
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031567 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00264800 predicted 1322
2 SASI_Rn02_00264801 predicted 617
3 SASI_Rn02_00264802 predicted 400
4 SASI_Rn02_00264803 predicted 689
5 SASI_Rn02_00264804 predicted 984
6 SASI_Rn02_00264805 predicted 1312
7 SASI_Rn02_00264806 predicted 939
8 SASI_Rn02_00264807 predicted 332
9 SASI_Rn02_00264808 predicted 671
10 SASI_Rn02_00264809 predicted 987
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008688 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00032923 predicted 684
2 SASI_Mm01_00032924 predicted 727
3 SASI_Mm01_00032925 predicted 1035
4 SASI_Mm01_00032926 predicted 755
5 SASI_Mm01_00032927 predicted 431
6 SASI_Mm01_00032928 predicted 1009
7 SASI_Mm01_00032929 predicted 1048
8 SASI_Mm01_00032931 predicted 747
9 SASI_Mm02_00314493 predicted 553
10 SASI_Mm01_00032932 predicted 758
11 SASI_Mm01_00032930 predicted 999
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026756 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00046456 predicted 687
2 SASI_Mm01_00046457 predicted 729
3 SASI_Mm01_00046458 predicted 1034
4 SASI_Mm01_00046459 predicted 757
5 SASI_Mm01_00046460 predicted 435
6 SASI_Mm01_00046461 predicted 1009
7 SASI_Mm01_00046462 predicted 1049
8 SASI_Mm01_00046464 predicted 740
9 SASI_Mm02_00330806 predicted 547
10 SASI_Mm01_00046465 predicted 752
11 SASI_Mm01_00046463 predicted 1001
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008688
VALIDATED
NFIC MISSION shRNA Bacterial Glycerol Stock
nuclear factor I/C (CCAAT-binding transcription factor)
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000379000    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008688.3-1384s21c1
Sequence:CCGGATTAGGACGGAGGGATCCTCTCTCGAGAGAGGATCCCTCCGTCCTAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000310992    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008688.3-555s21c1
Sequence:CCGGTGTGTGCAGCCGCACCATATTCTCGAGAATATGGTGCGGCTGCACACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000310995    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008688.3-1000s21c1
Sequence:CCGGGCAACTGGACGGAAGACATAGCTCGAGCTATGTCTTCCGTCCAGTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301779    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008688.3-1055s21c1
Sequence:CCGGGATGGACAAATCTCCATTCAACTCGAGTTGAATGGAGATTTGTCCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000310997    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008688.3-598s21c1
Sequence:CCGGACCTGTACCTGGCCTACTTTGCTCGAGCAAAGTAGGCCAGGTACAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374154    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008688.3-1214s21c1
Sequence:CCGGACAGACAGCCTCCACCTACTTCTCGAGAAGTAGGTGGAGGCTGTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374212    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008688.3-732s21c1
Sequence:CCGGACGTCAGGTGTGTTCAGTGTCCTCGAGGACACTGAACACACCTGACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082288    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008688.2-1415s1c1
Sequence:CCGGTAGCCGAGGTTGCCTTCCCATCTCGAGATGGGAAGGCAACCTCGGCTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008688.2-1345s1c1
Sequence:CCGGCCCTGCAAACAGTCCCTTTGTCTCGAGACAAAGGGACTGTTTGCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008688.2-318s1c1
Sequence:CCGGCGTGAAGACTTCGTACTGGCTCTCGAGAGCCAGTACGAAGTCTTCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082289    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008688.2-1040s1c1
Sequence:CCGGGATGGACAAATCTCCATTCAACTCGAGTTGAATGGAGATTTGTCCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082290    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008688.2-944s1c1
Sequence:CCGGCGACTACTACACGTCGCCCAACTCGAGTTGGGCGACGTGTAGTAGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008688
VALIDATED
NFIC MISSION shRNA shRNA Plasmid DNA
nuclear factor I/C (CCAAT-binding transcription factor)
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000379000    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008688.3-1384s21c1
Sequence:CCGGATTAGGACGGAGGGATCCTCTCTCGAGAGAGGATCCCTCCGTCCTAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000310992    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008688.3-555s21c1
Sequence:CCGGTGTGTGCAGCCGCACCATATTCTCGAGAATATGGTGCGGCTGCACACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000310995    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008688.3-1000s21c1
Sequence:CCGGGCAACTGGACGGAAGACATAGCTCGAGCTATGTCTTCCGTCCAGTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000301779    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008688.3-1055s21c1
Sequence:CCGGGATGGACAAATCTCCATTCAACTCGAGTTGAATGGAGATTTGTCCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000310997    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008688.3-598s21c1
Sequence:CCGGACCTGTACCTGGCCTACTTTGCTCGAGCAAAGTAGGCCAGGTACAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000374154    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008688.3-1214s21c1
Sequence:CCGGACAGACAGCCTCCACCTACTTCTCGAGAAGTAGGTGGAGGCTGTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000374212    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008688.3-732s21c1
Sequence:CCGGACGTCAGGTGTGTTCAGTGTCCTCGAGGACACTGAACACACCTGACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082288    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008688.2-1415s1c1
Sequence:CCGGTAGCCGAGGTTGCCTTCCCATCTCGAGATGGGAAGGCAACCTCGGCTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008688.2-1345s1c1
Sequence:CCGGCCCTGCAAACAGTCCCTTTGTCTCGAGACAAAGGGACTGTTTGCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008688.2-318s1c1
Sequence:CCGGCGTGAAGACTTCGTACTGGCTCTCGAGAGCCAGTACGAAGTCTTCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082289    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008688.2-1040s1c1
Sequence:CCGGGATGGACAAATCTCCATTCAACTCGAGTTGAATGGAGATTTGTCCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082290    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008688.2-944s1c1
Sequence:CCGGCGACTACTACACGTCGCCCAACTCGAGTTGGGCGACGTGTAGTAGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008688
VALIDATED
NFIC MISSION shRNA Lentiviral Transduction Particles
nuclear factor I/C (CCAAT-binding transcription factor)
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000379000    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008688.3-1384s21c1
Sequence:CCGGATTAGGACGGAGGGATCCTCTCTCGAGAGAGGATCCCTCCGTCCTAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000310992    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008688.3-555s21c1
Sequence:CCGGTGTGTGCAGCCGCACCATATTCTCGAGAATATGGTGCGGCTGCACACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000310995    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008688.3-1000s21c1
Sequence:CCGGGCAACTGGACGGAAGACATAGCTCGAGCTATGTCTTCCGTCCAGTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301779    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008688.3-1055s21c1
Sequence:CCGGGATGGACAAATCTCCATTCAACTCGAGTTGAATGGAGATTTGTCCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000310997    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008688.3-598s21c1
Sequence:CCGGACCTGTACCTGGCCTACTTTGCTCGAGCAAAGTAGGCCAGGTACAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374154    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008688.3-1214s21c1
Sequence:CCGGACAGACAGCCTCCACCTACTTCTCGAGAAGTAGGTGGAGGCTGTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374212    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008688.3-732s21c1
Sequence:CCGGACGTCAGGTGTGTTCAGTGTCCTCGAGGACACTGAACACACCTGACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082288    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008688.2-1415s1c1
Sequence:CCGGTAGCCGAGGTTGCCTTCCCATCTCGAGATGGGAAGGCAACCTCGGCTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008688.2-1345s1c1
Sequence:CCGGCCCTGCAAACAGTCCCTTTGTCTCGAGACAAAGGGACTGTTTGCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008688.2-318s1c1
Sequence:CCGGCGTGAAGACTTCGTACTGGCTCTCGAGAGCCAGTACGAAGTCTTCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082289    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008688.2-1040s1c1
Sequence:CCGGGATGGACAAATCTCCATTCAACTCGAGTTGAATGGAGATTTGTCCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082290    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008688.2-944s1c1
Sequence:CCGGCGACTACTACACGTCGCCCAACTCGAGTTGGGCGACGTGTAGTAGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005597
VALIDATED
NFIC MISSION shRNA Bacterial Glycerol Stock
nuclear factor I/C (CCAAT-binding transcription factor)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000297065    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005597.2-902s21c1
Sequence:CCGGGCGGCACAAATCGGGCTCGATCTCGAGATCGAGCCCGATTTGTGCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277967    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005597.2-1171s21c1
Sequence:CCGGCCTCCGCTCTGCATTTCCCTACTCGAGTAGGGAAATGCAGAGCGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277970    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005597.2-1049s21c1
Sequence:CCGGGATGGACAAGTCACCATTCAACTCGAGTTGAATGGTGACTTGTCCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278027    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005597.2-1031s21c1
Sequence:CCGGCCCGGTGAAGAAGACAGAGATCTCGAGATCTCTGTCTTCTTCACCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000297066    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005597.2-1565s21c1
Sequence:CCGGCCACCCAAGCAAGAAGACAAACTCGAGTTTGTCTTCTTGCTTGGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014708    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_005597.2-1565s1c1
Sequence:CCGGCCACCCAAGCAAGAAGACAAACTCGAGTTTGTCTTCTTGCTTGGGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014712    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_005597.2-1171s1c1
Sequence:CCGGCCTCCGCTCTGCATTTCCCTACTCGAGTAGGGAAATGCAGAGCGGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014711    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_005597.2-1031s1c1
Sequence:CCGGCCCGGTGAAGAAGACAGAGATCTCGAGATCTCTGTCTTCTTCACCGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014710    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_005597.2-902s1c1
Sequence:CCGGGCGGCACAAATCGGGCTCGATCTCGAGATCGAGCCCGATTTGTGCCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005597
VALIDATED
NFIC MISSION shRNA shRNA Plasmid DNA
nuclear factor I/C (CCAAT-binding transcription factor)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000297065    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005597.2-902s21c1
Sequence:CCGGGCGGCACAAATCGGGCTCGATCTCGAGATCGAGCCCGATTTGTGCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000277967    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005597.2-1171s21c1
Sequence:CCGGCCTCCGCTCTGCATTTCCCTACTCGAGTAGGGAAATGCAGAGCGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000277970    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005597.2-1049s21c1
Sequence:CCGGGATGGACAAGTCACCATTCAACTCGAGTTGAATGGTGACTTGTCCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278027    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005597.2-1031s21c1
Sequence:CCGGCCCGGTGAAGAAGACAGAGATCTCGAGATCTCTGTCTTCTTCACCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000297066    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005597.2-1565s21c1
Sequence:CCGGCCACCCAAGCAAGAAGACAAACTCGAGTTTGTCTTCTTGCTTGGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014708    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_005597.2-1565s1c1
Sequence:CCGGCCACCCAAGCAAGAAGACAAACTCGAGTTTGTCTTCTTGCTTGGGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014712    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_005597.2-1171s1c1
Sequence:CCGGCCTCCGCTCTGCATTTCCCTACTCGAGTAGGGAAATGCAGAGCGGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014711    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_005597.2-1031s1c1
Sequence:CCGGCCCGGTGAAGAAGACAGAGATCTCGAGATCTCTGTCTTCTTCACCGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014710    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_005597.2-902s1c1
Sequence:CCGGGCGGCACAAATCGGGCTCGATCTCGAGATCGAGCCCGATTTGTGCCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005597
VALIDATED
NFIC MISSION shRNA Lentiviral Transduction Particles
nuclear factor I/C (CCAAT-binding transcription factor)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000297065    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005597.2-902s21c1
Sequence:CCGGGCGGCACAAATCGGGCTCGATCTCGAGATCGAGCCCGATTTGTGCCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277967    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005597.2-1171s21c1
Sequence:CCGGCCTCCGCTCTGCATTTCCCTACTCGAGTAGGGAAATGCAGAGCGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277970    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005597.2-1049s21c1
Sequence:CCGGGATGGACAAGTCACCATTCAACTCGAGTTGAATGGTGACTTGTCCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278027    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005597.2-1031s21c1
Sequence:CCGGCCCGGTGAAGAAGACAGAGATCTCGAGATCTCTGTCTTCTTCACCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000297066    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005597.2-1565s21c1
Sequence:CCGGCCACCCAAGCAAGAAGACAAACTCGAGTTTGTCTTCTTGCTTGGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014708    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_005597.2-1565s1c1
Sequence:CCGGCCACCCAAGCAAGAAGACAAACTCGAGTTTGTCTTCTTGCTTGGGTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014712    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_005597.2-1171s1c1
Sequence:CCGGCCTCCGCTCTGCATTTCCCTACTCGAGTAGGGAAATGCAGAGCGGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014711    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_005597.2-1031s1c1
Sequence:CCGGCCCGGTGAAGAAGACAGAGATCTCGAGATCTCTGTCTTCTTCACCGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014710    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_005597.2-902s1c1
Sequence:CCGGGCGGCACAAATCGGGCTCGATCTCGAGATCGAGCCCGATTTGTGCCGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)