EMAIL THIS PAGE TO A FRIEND

NFIL3

nuclear factor, interleukin 3 regulated

83 Gene Product Result for
Synonyms: E4BP4 IL3BP1 NF-IL3A NFIL3A
UniProtKB ID: Q16649, B2R9Y8, Q14211, Q6FGQ8, Q96HS0
Gene ID:
Human(4783) Summary: Expression of interleukin-3 (IL3; MIM 147740) is restricted to activated T cells, natural killer (NK) cells, and mast cell lines. Transcription initiation depends on the activating capacity of specific protein factors, such as NFIL3, that bind to regulatory regions of the gene, usually upstream of the transcription start site (Zhang et al., 1995 [PubMed 7565758]
Mouse(18030) nuclear factor, interleukin 3, regulated
Rat(114519) nuclear factor, interleukin 3 regulated
domestic guinea pig(100726742) nuclear factor, interleukin 3 regulated
naked mole-rat(101717875) nuclear factor, interleukin 3 regulated
sheep(100217409) nuclear factor, interleukin 3 regulated
Zebrafish(445509) nuclear factor, interleukin 3 regulated
cow(506097) nuclear factor, interleukin 3 regulated
domestic cat(101087431) nuclear factor, interleukin 3 regulated
dog(476347) nuclear factor, interleukin 3 regulated
chicken(395326) nuclear factor, interleukin 3 regulated
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017373 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_017373 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_017373 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005384 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005384 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005384 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005384 Rosetta Predictions human pricing
NM_053727 Rosetta Predictions rat pricing
NM_017373 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005384 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00148805 predicted 826
2 SASI_Hs01_00148806 predicted 1415
3 SASI_Hs01_00148807 predicted 430
4 SASI_Hs01_00148808 predicted 1452
5 SASI_Hs01_00148809 predicted 854
6 SASI_Hs01_00148810 predicted 810
7 SASI_Hs01_00148811 predicted 1324
8 SASI_Hs01_00148813 predicted 1504
9 SASI_Hs01_00148814 predicted 1056
10 SASI_Hs02_00339501 predicted 788
11 SASI_Hs01_00148812 predicted 811
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053727 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00033502 predicted 800
2 SASI_Rn01_00033503 predicted 1571
3 SASI_Rn01_00033504 predicted 350
4 SASI_Rn01_00033505 predicted 762
5 SASI_Rn02_00266496 predicted 1264
6 SASI_Rn01_00033506 predicted 710
7 SASI_Rn01_00033507 predicted 1327
8 SASI_Rn01_00033508 predicted 920
9 SASI_Rn01_00033509 predicted 1646
10 SASI_Rn01_00033510 predicted 1232
11 SASI_Rn01_00033501 predicted 658
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017373 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00167951 predicted 1354
2 SASI_Mm01_00167952 predicted 847
3 SASI_Mm01_00167953 predicted 749
4 SASI_Mm02_00323857 predicted 519
5 SASI_Mm01_00167954 predicted 1764
6 SASI_Mm01_00167955 predicted 1344
7 SASI_Mm01_00167956 predicted 519
8 SASI_Mm02_00323858 predicted 1584
9 SASI_Mm01_00167958 predicted 758
10 SASI_Mm01_00167959 predicted 744
11 SASI_Mm01_00167957 predicted 857
12 SASI_Mm01_00167960 predicted 1683
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017373
NFIL3 MISSION shRNA Bacterial Glycerol Stock
nuclear factor, interleukin 3 regulated
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000417112    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017373.3-1706s21c1
Sequence:CCGGGCTTCGGACTCCAGGTAAATGCTCGAGCATTTACCTGGAGTCCGAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414461    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017373.3-1350s21c1
Sequence:CCGGAGGCTTTGGACAGCGAGTTTGCTCGAGCAAACTCGCTGTCCAAAGCCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017373.2-694s1c1
Sequence:CCGGCGGAAGTTGCATCTCAGTCATCTCGAGATGACTGAGATGCAACTTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082338    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017373.2-1625s1c1
Sequence:CCGGCCACTGGACCTCTAAAGTCATCTCGAGATGACTTTAGAGGTCCAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082341    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017373.2-540s1c1
Sequence:CCGGCCCTGAAATTAAAGTTTGGTTCTCGAGAACCAAACTTTAATTTCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017373.2-395s1c1
Sequence:CCGGGACGCCATGTATTGGGAGAAACTCGAGTTTCTCCCAATACATGGCGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082340    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017373.2-1456s1c1
Sequence:CCGGCGAAGCTGAGAATTTGTATTTCTCGAGAAATACAAATTCTCAGCTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017373
NFIL3 MISSION shRNA shRNA Plasmid DNA
nuclear factor, interleukin 3 regulated
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000417112    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017373.3-1706s21c1
Sequence:CCGGGCTTCGGACTCCAGGTAAATGCTCGAGCATTTACCTGGAGTCCGAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414461    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017373.3-1350s21c1
Sequence:CCGGAGGCTTTGGACAGCGAGTTTGCTCGAGCAAACTCGCTGTCCAAAGCCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017373.2-694s1c1
Sequence:CCGGCGGAAGTTGCATCTCAGTCATCTCGAGATGACTGAGATGCAACTTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082338    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017373.2-1625s1c1
Sequence:CCGGCCACTGGACCTCTAAAGTCATCTCGAGATGACTTTAGAGGTCCAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082341    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017373.2-540s1c1
Sequence:CCGGCCCTGAAATTAAAGTTTGGTTCTCGAGAACCAAACTTTAATTTCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017373.2-395s1c1
Sequence:CCGGGACGCCATGTATTGGGAGAAACTCGAGTTTCTCCCAATACATGGCGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082340    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017373.2-1456s1c1
Sequence:CCGGCGAAGCTGAGAATTTGTATTTCTCGAGAAATACAAATTCTCAGCTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017373
NFIL3 MISSION shRNA Lentiviral Transduction Particles
nuclear factor, interleukin 3 regulated
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000417112    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017373.3-1706s21c1
Sequence:CCGGGCTTCGGACTCCAGGTAAATGCTCGAGCATTTACCTGGAGTCCGAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414461    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017373.3-1350s21c1
Sequence:CCGGAGGCTTTGGACAGCGAGTTTGCTCGAGCAAACTCGCTGTCCAAAGCCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017373.2-694s1c1
Sequence:CCGGCGGAAGTTGCATCTCAGTCATCTCGAGATGACTGAGATGCAACTTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082338    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017373.2-1625s1c1
Sequence:CCGGCCACTGGACCTCTAAAGTCATCTCGAGATGACTTTAGAGGTCCAGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082341    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017373.2-540s1c1
Sequence:CCGGCCCTGAAATTAAAGTTTGGTTCTCGAGAACCAAACTTTAATTTCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017373.2-395s1c1
Sequence:CCGGGACGCCATGTATTGGGAGAAACTCGAGTTTCTCCCAATACATGGCGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082340    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017373.2-1456s1c1
Sequence:CCGGCGAAGCTGAGAATTTGTATTTCTCGAGAAATACAAATTCTCAGCTTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005384
VALIDATED
NFIL3 MISSION shRNA Bacterial Glycerol Stock
nuclear factor, interleukin 3 regulated
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000234571    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005384.2-1767s21c1
Sequence:CCGGGCTTCAGACTCTGGGTAAATTCTCGAGAATTTACCCAGAGTCTGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234568    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005384.2-462s21c1
Sequence:CCGGGACAAGATGATGGTCCTTAATCTCGAGATTAAGGACCATCATCTTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005384.1-1105s1c1
Sequence:CCGGCCCATCCATTCTCCAGTTGAACTCGAGTTCAACTGGAGAATGGATGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234572    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_005384.2-1826s21c1
Sequence:CCGGTTGCAATAGAGCAGTCCATTTCTCGAGAAATGGACTGCTCTATTGCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234569    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005384.2-1387s21c1
Sequence:CCGGCCAAAGCCATGCAGATCAAAGCTCGAGCTTTGATCTGCATGGCTTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014738    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_005384.1-1746s1c1
Sequence:CCGGGCACAGATTATGATGAAGATTCTCGAGAATCTTCATCATAATCTGTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014740    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_005384.1-677s1c1
Sequence:CCGGCCAAATCCAATGTGAGTTCATCTCGAGATGAACTCACATTGGATTTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014741    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_005384.1-1216s1c1
Sequence:CCGGCAGATCAAAGTAGAAGCCTTTCTCGAGAAAGGCTTCTACTTTGATCTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234570    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005384.2-1455s21c1
Sequence:CCGGCCTATTGACATGACATCTAAACTCGAGTTTAGATGTCATGTCAATAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014742    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005384.1-290s1c1
Sequence:CCGGTGGTCCTTAATTCTGCTTTAACTCGAGTTAAAGCAGAATTAAGGACCATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005384
VALIDATED
NFIL3 MISSION shRNA shRNA Plasmid DNA
nuclear factor, interleukin 3 regulated
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000234571    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005384.2-1767s21c1
Sequence:CCGGGCTTCAGACTCTGGGTAAATTCTCGAGAATTTACCCAGAGTCTGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234568    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005384.2-462s21c1
Sequence:CCGGGACAAGATGATGGTCCTTAATCTCGAGATTAAGGACCATCATCTTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005384.1-1105s1c1
Sequence:CCGGCCCATCCATTCTCCAGTTGAACTCGAGTTCAACTGGAGAATGGATGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234572    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_005384.2-1826s21c1
Sequence:CCGGTTGCAATAGAGCAGTCCATTTCTCGAGAAATGGACTGCTCTATTGCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234569    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005384.2-1387s21c1
Sequence:CCGGCCAAAGCCATGCAGATCAAAGCTCGAGCTTTGATCTGCATGGCTTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014738    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_005384.1-1746s1c1
Sequence:CCGGGCACAGATTATGATGAAGATTCTCGAGAATCTTCATCATAATCTGTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014740    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_005384.1-677s1c1
Sequence:CCGGCCAAATCCAATGTGAGTTCATCTCGAGATGAACTCACATTGGATTTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014741    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_005384.1-1216s1c1
Sequence:CCGGCAGATCAAAGTAGAAGCCTTTCTCGAGAAAGGCTTCTACTTTGATCTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234570    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005384.2-1455s21c1
Sequence:CCGGCCTATTGACATGACATCTAAACTCGAGTTTAGATGTCATGTCAATAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014742    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005384.1-290s1c1
Sequence:CCGGTGGTCCTTAATTCTGCTTTAACTCGAGTTAAAGCAGAATTAAGGACCATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005384
VALIDATED
NFIL3 MISSION shRNA Lentiviral Transduction Particles
nuclear factor, interleukin 3 regulated
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000234571    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005384.2-1767s21c1
Sequence:CCGGGCTTCAGACTCTGGGTAAATTCTCGAGAATTTACCCAGAGTCTGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234568    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005384.2-462s21c1
Sequence:CCGGGACAAGATGATGGTCCTTAATCTCGAGATTAAGGACCATCATCTTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005384.1-1105s1c1
Sequence:CCGGCCCATCCATTCTCCAGTTGAACTCGAGTTCAACTGGAGAATGGATGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234572    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_005384.2-1826s21c1
Sequence:CCGGTTGCAATAGAGCAGTCCATTTCTCGAGAAATGGACTGCTCTATTGCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234569    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005384.2-1387s21c1
Sequence:CCGGCCAAAGCCATGCAGATCAAAGCTCGAGCTTTGATCTGCATGGCTTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014738    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_005384.1-1746s1c1
Sequence:CCGGGCACAGATTATGATGAAGATTCTCGAGAATCTTCATCATAATCTGTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014740    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_005384.1-677s1c1
Sequence:CCGGCCAAATCCAATGTGAGTTCATCTCGAGATGAACTCACATTGGATTTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014741    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_005384.1-1216s1c1
Sequence:CCGGCAGATCAAAGTAGAAGCCTTTCTCGAGAAAGGCTTCTACTTTGATCTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234570    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005384.2-1455s21c1
Sequence:CCGGCCTATTGACATGACATCTAAACTCGAGTTTAGATGTCATGTCAATAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014742    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005384.1-290s1c1
Sequence:CCGGTGGTCCTTAATTCTGCTTTAACTCGAGTTAAAGCAGAATTAAGGACCATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)