EMAIL THIS PAGE TO A FRIEND

NFIX

nuclear factor I/X (CCAAT-binding transcription factor)

242 Gene Product Result for
Synonyms: MRSHSS NF1A SOTOS2
Gene ID:
Human(4784) Summary: The protein encoded by this gene is a transcription factor that binds the palindromic sequence 5'-TTGGCNNNNNGCCAA-3 in viral and cellular promoters. The encoded protein can also stimulate adenovirus replication in vitro. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2012]
Mouse(18032) nuclear factor I/X
Rat(81524) nuclear factor I/X (CCAAT-binding transcription factor)
chicken(396207) nuclear factor I/X (CCAAT-binding transcription factor)
domestic cat(101088061) nuclear factor I/X (CCAAT-binding transcription factor)
cow(536348) nuclear factor I/X (CCAAT-binding transcription factor)
Horse(100064007) nuclear factor I/X (CCAAT-binding transcription factor)
dog(484920) nuclear factor I/X (CCAAT-binding transcription factor)
sheep(101103719) nuclear factor I/X (CCAAT-binding transcription factor)
naked mole-rat(101722219) nuclear factor I/X (CCAAT-binding transcription factor)
domestic guinea pig(100727106) nuclear factor I/X (CCAAT-binding transcription factor)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010906 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010906 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010906 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002501 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002501 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002501 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002501 Rosetta Predictions human pricing
NM_030866 Rosetta Predictions rat pricing
NM_001081981 Rosetta Predictions mouse pricing
NM_001081982 Rosetta Predictions mouse pricing
NM_010906 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002501 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00083300 predicted 618
2 SASI_Hs01_00083301 predicted 1679
3 SASI_Hs02_00333959 predicted 745
4 SASI_Hs01_00083303 predicted 600
5 SASI_Hs01_00083304 predicted 1694
6 SASI_Hs01_00083305 predicted 398
7 SASI_Hs01_00083306 predicted 918
8 SASI_Hs02_00333960 predicted 694
9 SASI_Hs01_00083308 predicted 1416
10 SASI_Hs01_00083309 predicted 561
11 SASI_Hs01_00083302 predicted 1263
12 SASI_Hs01_00083307 predicted 687
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030866 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00264117 predicted 1164
2 SASI_Rn02_00264118 predicted 290
3 SASI_Rn02_00264119 predicted 593
4 SASI_Rn02_00264120 predicted 564
5 SASI_Rn02_00264121 predicted 728
6 SASI_Rn02_00264122 predicted 892
7 SASI_Rn02_00264123 predicted 788
8 SASI_Rn02_00264124 predicted 215
9 SASI_Rn02_00264125 predicted 625
10 SASI_Rn02_00264126 predicted 366
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081981 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00299192 predicted 2941
2 SASI_Mm02_00299193 predicted 1549
3 SASI_Mm02_00299194 predicted 2769
4 SASI_Mm02_00299195 predicted 1526
5 SASI_Mm02_00299196 predicted 1502
6 SASI_Mm02_00299197 predicted 1575
7 SASI_Mm02_00299198 predicted 1319
8 SASI_Mm02_00299199 predicted 1483
9 SASI_Mm02_00299200 predicted 2929
10 SASI_Mm02_00299201 predicted 1491
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081982 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00299202 predicted 2119
2 SASI_Mm02_00299203 predicted 865
3 SASI_Mm02_00299204 predicted 1950
4 SASI_Mm02_00299205 predicted 846
5 SASI_Mm02_00299206 predicted 825
6 SASI_Mm02_00299207 predicted 901
7 SASI_Mm02_00299208 predicted 645
8 SASI_Mm02_00299209 predicted 812
9 SASI_Mm02_00299210 predicted 2111
10 SASI_Mm02_00299211 predicted 808
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010906 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00319632 predicted 1993
2 SASI_Mm01_00146092 predicted 866
3 SASI_Mm02_00319633 predicted 1821
4 SASI_Mm01_00146093 predicted 849
5 SASI_Mm01_00146095 predicted 831
6 SASI_Mm01_00146096 predicted 902
7 SASI_Mm01_00146097 predicted 643
8 SASI_Mm01_00146098 predicted 805
9 SASI_Mm02_00319634 predicted 1986
10 SASI_Mm01_00146100 predicted 807
11 SASI_Mm01_00146091 predicted 870
12 SASI_Mm01_00146094 predicted 305
13 SASI_Mm01_00146099 predicted 871
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010906
VALIDATED
NFIX MISSION shRNA Bacterial Glycerol Stock
nuclear factor I/X (CCAAT-binding transcription factor)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000257244    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010906.2-702s21c1
Sequence:CCGGTGGACCTGGTCATGGTGATTTCTCGAGAAATCACCATGACCAGGTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218767    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010906.2-843s21c1
Sequence:GTACCGGACCTTTATCTGGCTTACTTTGCTCGAGCAAAGTAAGCCAGATAAAGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000225947    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010906.2-2002s21c1
Sequence:CCGGTCGTAACAATAGTAGACATTCCTCGAGGAATGTCTACTATTGTTACGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000225946    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010906.2-932s21c1
Sequence:CCGGCCCAACGGGCACTTAAGTTTCCTCGAGGAAACTTAAGTGCCCGTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000225945    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010906.2-874s21c1
Sequence:CCGGGGAATCCGGACAATCAGATAGCTCGAGCTATCTGATTGTCCGGATTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075349    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010906.1-681s1c1
Sequence:CCGGCCGGACAATCAGATAGTTCAACTCGAGTTGAACTATCTGATTGTCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075352    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010906.1-394s1c1
Sequence:CCGGGCTAACCATCACGGGCAAGAACTCGAGTTCTTGCCCGTGATGGTTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075348    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010906.1-869s1c1
Sequence:CCGGCCCAGCTACTACAACATAAATCTCGAGATTTATGTTGTAGTAGCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010906.1-1137s1c1
Sequence:CCGGGCCCGTATTTCACACACCCAACTCGAGTTGGGTGTGTGAAATACGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075350    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010906.1-630s1c1
Sequence:CCGGCAATCAAAGAACTGGACCTTTCTCGAGAAAGGTCCAGTTCTTTGATTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010906
VALIDATED
NFIX MISSION shRNA shRNA Plasmid DNA
nuclear factor I/X (CCAAT-binding transcription factor)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000257244    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010906.2-702s21c1
Sequence:CCGGTGGACCTGGTCATGGTGATTTCTCGAGAAATCACCATGACCAGGTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218767    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010906.2-843s21c1
Sequence:GTACCGGACCTTTATCTGGCTTACTTTGCTCGAGCAAAGTAAGCCAGATAAAGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000225947    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010906.2-2002s21c1
Sequence:CCGGTCGTAACAATAGTAGACATTCCTCGAGGAATGTCTACTATTGTTACGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000225946    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010906.2-932s21c1
Sequence:CCGGCCCAACGGGCACTTAAGTTTCCTCGAGGAAACTTAAGTGCCCGTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000225945    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010906.2-874s21c1
Sequence:CCGGGGAATCCGGACAATCAGATAGCTCGAGCTATCTGATTGTCCGGATTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075349    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010906.1-681s1c1
Sequence:CCGGCCGGACAATCAGATAGTTCAACTCGAGTTGAACTATCTGATTGTCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075352    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010906.1-394s1c1
Sequence:CCGGGCTAACCATCACGGGCAAGAACTCGAGTTCTTGCCCGTGATGGTTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075348    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010906.1-869s1c1
Sequence:CCGGCCCAGCTACTACAACATAAATCTCGAGATTTATGTTGTAGTAGCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010906.1-1137s1c1
Sequence:CCGGGCCCGTATTTCACACACCCAACTCGAGTTGGGTGTGTGAAATACGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075350    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010906.1-630s1c1
Sequence:CCGGCAATCAAAGAACTGGACCTTTCTCGAGAAAGGTCCAGTTCTTTGATTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010906
VALIDATED
NFIX MISSION shRNA Lentiviral Transduction Particles
nuclear factor I/X (CCAAT-binding transcription factor)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000257244    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010906.2-702s21c1
Sequence:CCGGTGGACCTGGTCATGGTGATTTCTCGAGAAATCACCATGACCAGGTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218767    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010906.2-843s21c1
Sequence:GTACCGGACCTTTATCTGGCTTACTTTGCTCGAGCAAAGTAAGCCAGATAAAGGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000225947    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010906.2-2002s21c1
Sequence:CCGGTCGTAACAATAGTAGACATTCCTCGAGGAATGTCTACTATTGTTACGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000225946    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010906.2-932s21c1
Sequence:CCGGCCCAACGGGCACTTAAGTTTCCTCGAGGAAACTTAAGTGCCCGTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000225945    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010906.2-874s21c1
Sequence:CCGGGGAATCCGGACAATCAGATAGCTCGAGCTATCTGATTGTCCGGATTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075349    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010906.1-681s1c1
Sequence:CCGGCCGGACAATCAGATAGTTCAACTCGAGTTGAACTATCTGATTGTCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075352    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010906.1-394s1c1
Sequence:CCGGGCTAACCATCACGGGCAAGAACTCGAGTTCTTGCCCGTGATGGTTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075348    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010906.1-869s1c1
Sequence:CCGGCCCAGCTACTACAACATAAATCTCGAGATTTATGTTGTAGTAGCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010906.1-1137s1c1
Sequence:CCGGGCCCGTATTTCACACACCCAACTCGAGTTGGGTGTGTGAAATACGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075350    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010906.1-630s1c1
Sequence:CCGGCAATCAAAGAACTGGACCTTTCTCGAGAAAGGTCCAGTTCTTTGATTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002501
VALIDATED
NFIX MISSION shRNA Bacterial Glycerol Stock
nuclear factor I/X (CCAAT-binding transcription factor)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000234767    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_002501.2-626s21c1
Sequence:CCGGGGAATCCGGACAATCAGATAGCTCGAGCTATCTGATTGTCCGGATTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234766    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_002501.2-595s21c1
Sequence:CCGGATCTTTATCTGGCTTACTTTGCTCGAGCAAAGTAAGCCAGATAAAGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234765    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_002501.2-568s21c1
Sequence:CCGGACATTGGAGTCACAATCAAAGCTCGAGCTTTGATTGTGACTCCAATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234768    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_002501.2-684s21c1
Sequence:CCGGCCCAACGGGCACTTAAGTTTCCTCGAGGAAACTTAAGTGCCCGTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234769    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_002501.2-5199s21c1
Sequence:CCGGTAGGCTAAGAAACGCAGTATACTCGAGTATACTGCGTTTCTTAGCCTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014773    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002501.1-1373s1c1
Sequence:CCGGGCAGTCTCAGTCCTGGTTCCTCTCGAGAGGAACCAGGACTGAGACTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002501.1-530s1c1
Sequence:CCGGCACATCACATTGGAGTCACAACTCGAGTTGTGACTCCAATGTGATGTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014774    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002501.1-901s1c1
Sequence:CCGGCCTGTTGATGACGTGTTCTATCTCGAGATAGAACACGTCATCAACAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014775    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002501.1-558s1c1
Sequence:CCGGACTGGATCTTTATCTGGCTTACTCGAGTAAGCCAGATAAAGATCCAGTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002501.1-994s1c1
Sequence:CCGGCCGGCTTCTCTAAAGAAGTCACTCGAGTGACTTCTTTAGAGAAGCCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002501
VALIDATED
NFIX MISSION shRNA shRNA Plasmid DNA
nuclear factor I/X (CCAAT-binding transcription factor)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000234767    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_002501.2-626s21c1
Sequence:CCGGGGAATCCGGACAATCAGATAGCTCGAGCTATCTGATTGTCCGGATTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234766    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_002501.2-595s21c1
Sequence:CCGGATCTTTATCTGGCTTACTTTGCTCGAGCAAAGTAAGCCAGATAAAGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234765    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_002501.2-568s21c1
Sequence:CCGGACATTGGAGTCACAATCAAAGCTCGAGCTTTGATTGTGACTCCAATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234768    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_002501.2-684s21c1
Sequence:CCGGCCCAACGGGCACTTAAGTTTCCTCGAGGAAACTTAAGTGCCCGTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234769    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_002501.2-5199s21c1
Sequence:CCGGTAGGCTAAGAAACGCAGTATACTCGAGTATACTGCGTTTCTTAGCCTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014773    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002501.1-1373s1c1
Sequence:CCGGGCAGTCTCAGTCCTGGTTCCTCTCGAGAGGAACCAGGACTGAGACTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002501.1-530s1c1
Sequence:CCGGCACATCACATTGGAGTCACAACTCGAGTTGTGACTCCAATGTGATGTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014774    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002501.1-901s1c1
Sequence:CCGGCCTGTTGATGACGTGTTCTATCTCGAGATAGAACACGTCATCAACAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014775    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002501.1-558s1c1
Sequence:CCGGACTGGATCTTTATCTGGCTTACTCGAGTAAGCCAGATAAAGATCCAGTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002501.1-994s1c1
Sequence:CCGGCCGGCTTCTCTAAAGAAGTCACTCGAGTGACTTCTTTAGAGAAGCCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002501
VALIDATED
NFIX MISSION shRNA Lentiviral Transduction Particles
nuclear factor I/X (CCAAT-binding transcription factor)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000234767    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_002501.2-626s21c1
Sequence:CCGGGGAATCCGGACAATCAGATAGCTCGAGCTATCTGATTGTCCGGATTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234766    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_002501.2-595s21c1
Sequence:CCGGATCTTTATCTGGCTTACTTTGCTCGAGCAAAGTAAGCCAGATAAAGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234765    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_002501.2-568s21c1
Sequence:CCGGACATTGGAGTCACAATCAAAGCTCGAGCTTTGATTGTGACTCCAATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234768    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_002501.2-684s21c1
Sequence:CCGGCCCAACGGGCACTTAAGTTTCCTCGAGGAAACTTAAGTGCCCGTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234769    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_002501.2-5199s21c1
Sequence:CCGGTAGGCTAAGAAACGCAGTATACTCGAGTATACTGCGTTTCTTAGCCTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014773    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002501.1-1373s1c1
Sequence:CCGGGCAGTCTCAGTCCTGGTTCCTCTCGAGAGGAACCAGGACTGAGACTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002501.1-530s1c1
Sequence:CCGGCACATCACATTGGAGTCACAACTCGAGTTGTGACTCCAATGTGATGTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014774    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002501.1-901s1c1
Sequence:CCGGCCTGTTGATGACGTGTTCTATCTCGAGATAGAACACGTCATCAACAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014775    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002501.1-558s1c1
Sequence:CCGGACTGGATCTTTATCTGGCTTACTCGAGTAAGCCAGATAAAGATCCAGTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002501.1-994s1c1
Sequence:CCGGCCGGCTTCTCTAAAGAAGTCACTCGAGTGACTTCTTTAGAGAAGCCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)