EMAIL THIS PAGE TO A FRIEND

NFKB1

nuclear factor of kappa light polypeptide gene enhancer in B-cells 1

144 Gene Product Result for
Synonyms: EBP-1 KBF1 NF-kB1 NF-kappa-B NF-kappaB NFKB-p105 NFKB-p50 NFkappaB p105 p50
Gene ID:
Human(4790) Summary: This gene encodes a 105 kD protein which can undergo cotranslational processing by the 26S proteasome to produce a 50 kD protein. The 105 kD protein is a Rel protein-specific transcription inhibitor and the 50 kD protein is a DNA binding subunit of the NF-kappa-B (NFKB) protein complex. NFKB is a transcription regulator that is activated by various intra- and extra-cellular stimuli such as cytokines, oxidant-free radicals, ultraviolet irradiation, and bacterial or viral products. Activated NFKB translocates into the nucleus and stimulates the expression of genes involved in a wide variety of biological functions. Inappropriate activation of NFKB has been associated with a number of inflammatory diseases while persistent inhibition of NFKB leads to inappropriate immune cell development or delayed cell growth. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2009]
Mouse(18033) nuclear factor of kappa light polypeptide gene enhancer in B cells 1, p105
Rat(81736) nuclear factor of kappa light polypeptide gene enhancer in B-cells 1
sheep(101108228) nuclear factor of kappa light polypeptide gene enhancer in B-cells 1
domestic guinea pig(100730075) nuclear factor of kappa light polypeptide gene enhancer in B-cells 1
naked mole-rat(101696485) nuclear factor of kappa light polypeptide gene enhancer in B-cells 1
Zebrafish(565756) nuclear factor of kappa light polypeptide gene enhancer in B-cells 1
chicken(396033) nuclear factor of kappa light polypeptide gene enhancer in B-cells 1
dog(442859) nuclear factor of kappa light polypeptide gene enhancer in B-cells 1
cow(616115) nuclear factor of kappa light polypeptide gene enhancer in B-cells 1
domestic cat(100142683) nuclear factor of kappa light polypeptide gene enhancer in B-cells 1
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4501989 Anti-NF-κB p105 antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, immunohistochemistry, western blot pricing
SAB4501986 Anti-NF-κB p105, C-Terminal antibody produced in rabbit affinity isolated antibody human, mouse
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB4501987 Anti-NF-κB p105, C-Terminal antibody produced in rabbit affinity isolated antibody human, rat, mouse
ELISA, immunohistochemistry pricing
SAB4501988 Anti-NF-κB p105, C-Terminal antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, immunohistochemistry, western blot pricing
SAB4501990 Anti-NF-κB p105, C-Terminal antibody produced in rabbit affinity isolated antibody human
ELISA, immunohistochemistry, western blot pricing
SAB4501991 Anti-NF-κB p105, C-Terminal antibody produced in rabbit affinity isolated antibody human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1305889 ANTI-NFKB(P105) (C-TERM S933) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
western blot pricing
SAB1105277 Anti-NFKB1 (786-800) antibody produced in rabbit IgG fraction of antiserum human
western blot pricing
SAB4300301 Anti-NFKB1 (Ab-337) antibody produced in rabbit affinity isolated antibody rat, mouse, human
immunohistochemistry, western blot pricing
SAB4300302 Anti-NFKB1 (Ab-893) antibody produced in rabbit affinity isolated antibody human
immunohistochemistry, western blot pricing
SAB4300303 Anti-NFKB1 (Ab-907) antibody produced in rabbit affinity isolated antibody human
immunohistochemistry, western blot pricing
SAB4300554 Anti-NFKB1 (Ab-927) antibody produced in rabbit affinity isolated antibody mouse, rat, human
immunofluorescence, western blot pricing
SAB4300498 Anti-NFKB1 (Ab-932) antibody produced in rabbit affinity isolated antibody human, mouse, rat
immunohistochemistry, western blot pricing
GW21167 Anti-NFKB1 antibody produced in chicken affinity isolated antibody, buffered aqueous solution mouse, rat, human
western blot pricing
SAB1406182 Anti-NFKB1 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
AV38413 Anti-NFKB1 antibody produced in rabbit affinity isolated antibody human, zebrafish, rabbit, horse, mouse, canine, pig, rat, guinea pig, bovine
western blot pricing
HPA027305 Anti-NFKB1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
SAB2103906 Anti-NFKB1 antibody produced in rabbit affinity isolated antibody bovine, canine, horse, human, rabbit, pig, mouse, rat
western blot pricing
SAB2702047 Anti-NFKB1 antibody produced in rabbit human, mouse
ChIP, immunocytochemistry, immunofluorescence, immunohistochemistry, immunoprecipitation (IP), western blot pricing
SAB4301140 Anti-NFKB1p105 antibody produced in rabbit affinity isolated antibody human
immunohistochemistry pricing
SAB4503948 Anti-phospho-NF-B p105 (pSer903) antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, immunohistochemistry pricing
SAB4504485 Anti-phospho-NF-kappaB p105/p50 (pSer337) antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, immunohistochemistry, western blot pricing
SAB4504486 Anti-phospho-NF-kappaB p105/p50 (pSer893) antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, immunohistochemistry, western blot pricing
SAB4504487 Anti-phospho-NF-kappaB p105/p50 (pSer907) antibody produced in rabbit affinity isolated antibody human, rat, mouse
ELISA, immunohistochemistry, western blot pricing
SAB4503772 Anti-phospho-NF-kappaB p105/p50 (pSer927) antibody produced in rabbit affinity isolated antibody human, rat, mouse
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB4504480 Anti-phospho-NF-kappaB p105/p50 (pSer932) antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, western blot pricing
SAB4300244 Anti-phospho-NFKB1 (pSer927) antibody produced in rabbit affinity isolated antibody mouse, rat, human
immunofluorescence, immunohistochemistry, western blot pricing
SAB4300199 Anti-phospho-NFKB1 (pSer932) antibody produced in rabbit affinity isolated antibody human, rat, mouse
immunohistochemistry, western blot pricing
N8523 Monoclonal Anti-NF-κB antibody produced in mouse clone NF-12, ascites fluid mouse, human
immunocytochemistry, microarray, western blot pricing
WH0004790M1 Monoclonal Anti-NFKB1 antibody produced in mouse clone 2E6, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, proximity ligation assay, western blot pricing
SAB1404125 Monoclonal Anti-NFKB1, (C-terminal) antibody produced in mouse clone 4A11, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, proximity ligation assay, western blot pricing
PLA0214 Rabbit anti-NF-kappaB1 Antibody, Affinity Purified Powered by Bethyl Laboratories, Inc. rhesus monkey, gibbon, gorilla, chimpanzee, marmoset, primate, human
immunoprecipitation (IP), proximity ligation assay pricing

Small Molecule - Antagonist

Product # Description Species Add to Cart
 
SML1135 MG-132(R) ≥95% (HPLC) human pricing
C2211 Z-Leu-Leu-Leu-al ≥90% (HPLC) human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008689 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008689 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008689 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003998 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003998 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003998 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003998 Rosetta Predictions human pricing
XM_001075876 Rosetta Predictions rat pricing
XM_342346 Rosetta Predictions rat pricing
NM_008689 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003998 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00227679 predicted 1669
2 SASI_Hs01_00227680 predicted 3381
3 SASI_Hs01_00227681 predicted 1700
4 SASI_Hs01_00227682 predicted 2850
5 SASI_Hs02_00336719 predicted 1166
6 SASI_Hs01_00227684 predicted 1683
7 SASI_Hs01_00227685 predicted 876
8 SASI_Hs01_00227686 predicted 3264
9 SASI_Hs01_00227687 predicted 730
10 SASI_Hs02_00336720 predicted 935
11 SASI_Hs01_00227683 predicted 3445
12 SASI_Hs01_00227688 predicted 2161
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001075876 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00351346 predicted 402
2 SASI_Rn02_00351347 predicted 1289
3 SASI_Rn02_00351348 predicted 980
4 SASI_Rn02_00351349 predicted 2746
5 SASI_Rn02_00351350 predicted 1853
6 SASI_Rn02_00351351 predicted 1713
7 SASI_Rn02_00351352 predicted 1320
8 SASI_Rn02_00351353 predicted 2359
9 SASI_Rn02_00351354 predicted 506
10 SASI_Rn02_00351355 predicted 997
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_342346 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00394167 predicted 870
2 SASI_Rn02_00394168 predicted 1752
3 SASI_Rn02_00394169 predicted 506
4 SASI_Rn02_00394170 predicted 3201
5 SASI_Rn02_00394171 predicted 2318
6 SASI_Rn02_00394172 predicted 1784
7 SASI_Rn02_00394173 predicted 2823
8 SASI_Rn02_00394174 predicted 1463
9 SASI_Rn02_00394175 predicted 605
10 SASI_Rn02_00394176 predicted 596
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008689 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00074010 predicted 3308
2 SASI_Mm01_00074011 predicted 2876
3 SASI_Mm01_00074012 predicted 1441
4 SASI_Mm01_00074013 predicted 1793
5 SASI_Mm01_00074014 predicted 910
6 SASI_Mm01_00074015 predicted 1411
7 SASI_Mm01_00074016 predicted 2432
8 SASI_Mm01_00074017 predicted 654
9 SASI_Mm01_00074018 predicted 2177
10 SASI_Mm01_00074019 predicted 2123
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008689
VALIDATED
NFKB1 MISSION shRNA Bacterial Glycerol Stock
nuclear factor of kappa light polypeptide gene enhancer in B-cells 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000009510    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008689.1-3318s1c1
Sequence:CCGGGCAGGGTCACTCGATTTCATTCTCGAGAATGAAATCGAGTGACCCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009511    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008689.1-2625s1c1
Sequence:CCGGGCAGGTATTTGACATACTAAACTCGAGTTTAGTATGTCAAATACCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008689.1-339s1c1
Sequence:CCGGCACTGCTTTGACTCACTCAATCTCGAGATTGAGTGAGTCAAAGCAGTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009513    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008689.1-1583s1c1
Sequence:CCGGGCACCATAAACACCAAATTTACTCGAGTAAATTTGGTGTTTATGGTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009512    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008689.1-3138s1c1
Sequence:CCGGCCCACTGCTATCTCTGAACAACTCGAGTTGTTCAGAGATAGCAGTGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008689.2-962s21c1
Sequence:CCGGCGGATGACAGAGGCGTGTATTCTCGAGAATACACGCCTCTGTCATCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235483    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008689.2-1783s21c1
Sequence:CCGGGGTCACCCATGGCACCATAAACTCGAGTTTATGGTGCCATGGGTGACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235482    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008689.2-1709s21c1
Sequence:CCGGGGCTACTCGAACTACGGATTTCTCGAGAAATCCGTAGTTCGAGTAGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008689.2-1446s21c1
Sequence:CCGGAGTATAAGGATGTCAACATTACTCGAGTAATGTTGACATCCTTATACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235484    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008689.2-3851s21c1
Sequence:CCGGAGTACCTTGATGCGCAATAAACTCGAGTTTATTGCGCATCAAGGTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008689
VALIDATED
NFKB1 MISSION shRNA shRNA Plasmid DNA
nuclear factor of kappa light polypeptide gene enhancer in B-cells 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000009510    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008689.1-3318s1c1
Sequence:CCGGGCAGGGTCACTCGATTTCATTCTCGAGAATGAAATCGAGTGACCCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009511    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008689.1-2625s1c1
Sequence:CCGGGCAGGTATTTGACATACTAAACTCGAGTTTAGTATGTCAAATACCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008689.1-339s1c1
Sequence:CCGGCACTGCTTTGACTCACTCAATCTCGAGATTGAGTGAGTCAAAGCAGTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009513    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008689.1-1583s1c1
Sequence:CCGGGCACCATAAACACCAAATTTACTCGAGTAAATTTGGTGTTTATGGTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009512    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008689.1-3138s1c1
Sequence:CCGGCCCACTGCTATCTCTGAACAACTCGAGTTGTTCAGAGATAGCAGTGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008689.2-962s21c1
Sequence:CCGGCGGATGACAGAGGCGTGTATTCTCGAGAATACACGCCTCTGTCATCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235483    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008689.2-1783s21c1
Sequence:CCGGGGTCACCCATGGCACCATAAACTCGAGTTTATGGTGCCATGGGTGACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235482    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008689.2-1709s21c1
Sequence:CCGGGGCTACTCGAACTACGGATTTCTCGAGAAATCCGTAGTTCGAGTAGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008689.2-1446s21c1
Sequence:CCGGAGTATAAGGATGTCAACATTACTCGAGTAATGTTGACATCCTTATACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235484    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008689.2-3851s21c1
Sequence:CCGGAGTACCTTGATGCGCAATAAACTCGAGTTTATTGCGCATCAAGGTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008689
VALIDATED
NFKB1 MISSION shRNA Lentiviral Transduction Particles
nuclear factor of kappa light polypeptide gene enhancer in B-cells 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000009510    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008689.1-3318s1c1
Sequence:CCGGGCAGGGTCACTCGATTTCATTCTCGAGAATGAAATCGAGTGACCCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009511    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008689.1-2625s1c1
Sequence:CCGGGCAGGTATTTGACATACTAAACTCGAGTTTAGTATGTCAAATACCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008689.1-339s1c1
Sequence:CCGGCACTGCTTTGACTCACTCAATCTCGAGATTGAGTGAGTCAAAGCAGTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009513    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008689.1-1583s1c1
Sequence:CCGGGCACCATAAACACCAAATTTACTCGAGTAAATTTGGTGTTTATGGTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009512    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008689.1-3138s1c1
Sequence:CCGGCCCACTGCTATCTCTGAACAACTCGAGTTGTTCAGAGATAGCAGTGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008689.2-962s21c1
Sequence:CCGGCGGATGACAGAGGCGTGTATTCTCGAGAATACACGCCTCTGTCATCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235483    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008689.2-1783s21c1
Sequence:CCGGGGTCACCCATGGCACCATAAACTCGAGTTTATGGTGCCATGGGTGACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235482    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008689.2-1709s21c1
Sequence:CCGGGGCTACTCGAACTACGGATTTCTCGAGAAATCCGTAGTTCGAGTAGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008689.2-1446s21c1
Sequence:CCGGAGTATAAGGATGTCAACATTACTCGAGTAATGTTGACATCCTTATACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235484    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008689.2-3851s21c1
Sequence:CCGGAGTACCTTGATGCGCAATAAACTCGAGTTTATTGCGCATCAAGGTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003998
VALIDATED
NFKB1 MISSION shRNA Bacterial Glycerol Stock
nuclear factor of kappa light polypeptide gene enhancer in B-cells 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000006521    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003998.2-936s1c1
Sequence:CCGGCGAATGACAGAGGCGTGTATACTCGAGTATACACGCCTCTGTCATTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006520    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003998.2-1506s1c1
Sequence:CCGGCCTTTCCTCTACTATCCTGAACTCGAGTTCAGGATAGTAGAGGAAAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006519    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003998.2-497s1c1
Sequence:CCGGGCCTGAACAAATGTTTCATTTCTCGAGAAATGAAACATTTGTTCAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006518    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003998.2-2853s1c1
Sequence:CCGGCCAGAGTTTACATCTGATGATCTCGAGATCATCAGATGTAAACTCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006517    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003998.2-3484s1c1
Sequence:CCGGCGCCTGAATCATTCTCGATTTCTCGAGAAATCGAGAATGATTCAGGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277780    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003998.2-936s21c1
Sequence:CCGGCGAATGACAGAGGCGTGTATACTCGAGTATACACGCCTCTGTCATTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277724    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003998.2-2853s21c1
Sequence:CCGGCCAGAGTTTACATCTGATGATCTCGAGATCATCAGATGTAAACTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277725    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003998.2-497s21c1
Sequence:CCGGGCCTGAACAAATGTTTCATTTCTCGAGAAATGAAACATTTGTTCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277783    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003998.2-1506s21c1
Sequence:CCGGCCTTTCCTCTACTATCCTGAACTCGAGTTCAGGATAGTAGAGGAAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277782    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003998.2-3484s21c1
Sequence:CCGGCGCCTGAATCATTCTCGATTTCTCGAGAAATCGAGAATGATTCAGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003998
VALIDATED
NFKB1 MISSION shRNA shRNA Plasmid DNA
nuclear factor of kappa light polypeptide gene enhancer in B-cells 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000006521    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003998.2-936s1c1
Sequence:CCGGCGAATGACAGAGGCGTGTATACTCGAGTATACACGCCTCTGTCATTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006520    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003998.2-1506s1c1
Sequence:CCGGCCTTTCCTCTACTATCCTGAACTCGAGTTCAGGATAGTAGAGGAAAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006519    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003998.2-497s1c1
Sequence:CCGGGCCTGAACAAATGTTTCATTTCTCGAGAAATGAAACATTTGTTCAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006518    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003998.2-2853s1c1
Sequence:CCGGCCAGAGTTTACATCTGATGATCTCGAGATCATCAGATGTAAACTCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006517    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003998.2-3484s1c1
Sequence:CCGGCGCCTGAATCATTCTCGATTTCTCGAGAAATCGAGAATGATTCAGGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000277780    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003998.2-936s21c1
Sequence:CCGGCGAATGACAGAGGCGTGTATACTCGAGTATACACGCCTCTGTCATTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000277724    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003998.2-2853s21c1
Sequence:CCGGCCAGAGTTTACATCTGATGATCTCGAGATCATCAGATGTAAACTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000277725    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003998.2-497s21c1
Sequence:CCGGGCCTGAACAAATGTTTCATTTCTCGAGAAATGAAACATTTGTTCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000277783    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003998.2-1506s21c1
Sequence:CCGGCCTTTCCTCTACTATCCTGAACTCGAGTTCAGGATAGTAGAGGAAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000277782    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003998.2-3484s21c1
Sequence:CCGGCGCCTGAATCATTCTCGATTTCTCGAGAAATCGAGAATGATTCAGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003998
VALIDATED
NFKB1 MISSION shRNA Lentiviral Transduction Particles
nuclear factor of kappa light polypeptide gene enhancer in B-cells 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000006521    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003998.2-936s1c1
Sequence:CCGGCGAATGACAGAGGCGTGTATACTCGAGTATACACGCCTCTGTCATTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006520    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003998.2-1506s1c1
Sequence:CCGGCCTTTCCTCTACTATCCTGAACTCGAGTTCAGGATAGTAGAGGAAAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006519    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003998.2-497s1c1
Sequence:CCGGGCCTGAACAAATGTTTCATTTCTCGAGAAATGAAACATTTGTTCAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006518    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003998.2-2853s1c1
Sequence:CCGGCCAGAGTTTACATCTGATGATCTCGAGATCATCAGATGTAAACTCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006517    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_003998.2-3484s1c1
Sequence:CCGGCGCCTGAATCATTCTCGATTTCTCGAGAAATCGAGAATGATTCAGGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277780    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003998.2-936s21c1
Sequence:CCGGCGAATGACAGAGGCGTGTATACTCGAGTATACACGCCTCTGTCATTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277724    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003998.2-2853s21c1
Sequence:CCGGCCAGAGTTTACATCTGATGATCTCGAGATCATCAGATGTAAACTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277725    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003998.2-497s21c1
Sequence:CCGGGCCTGAACAAATGTTTCATTTCTCGAGAAATGAAACATTTGTTCAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277783    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003998.2-1506s21c1
Sequence:CCGGCCTTTCCTCTACTATCCTGAACTCGAGTTCAGGATAGTAGAGGAAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277782    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003998.2-3484s21c1
Sequence:CCGGCGCCTGAATCATTCTCGATTTCTCGAGAAATCGAGAATGATTCAGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)