EMAIL THIS PAGE TO A FRIEND

NFKBIA

nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, alpha

86 Gene Product Result for
Synonyms: IKBA MAD-3 NFKBI
UniProtKB ID: P25963, B2R8L6
Gene ID:
Human(4792) Summary: This gene encodes a member of the NF-kappa-B inhibitor family, which contain multiple ankrin repeat domains. The encoded protein interacts with REL dimers to inhibit NF-kappa-B/REL complexes which are involved in inflammatory responses. The encoded protein moves between the cytoplasm and the nucleus via a nuclear localization signal and CRM1-mediated nuclear export. Mutations in this gene have been found in ectodermal dysplasia anhidrotic with T-cell immunodeficiency autosomal dominant disease. [provided by RefSeq, Aug 2011]
Mouse(18035) nuclear factor of kappa light polypeptide gene enhancer in B cells inhibitor, alpha
Rat(25493) nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, alpha
sheep(780520) nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, alpha
domestic guinea pig(100723189) nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, alpha
naked mole-rat(101709256) nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, alpha
chicken(396093) nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, alpha
cow(282291) nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, alpha
domestic cat(101090622) nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, alpha
dog(480291) nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, alpha
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1305978 ANTI-IKB ALPHA (IKBA) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB4501994 Anti-IκB-α antibody produced in rabbit affinity isolated antibody human, rat, mouse
ELISA, immunohistochemistry, western blot pricing
SAB4501995 Anti-IκB-α antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, immunohistochemistry, western blot pricing
I0505 Anti-IκBα antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution mouse, rat, human
microarray, western blot pricing
SAB4300395 Anti-NFKBIA (Ab-32/36) antibody produced in rabbit affinity isolated antibody mouse, human
immunofluorescence, immunohistochemistry, western blot pricing
SAB4300440 Anti-NFKBIA (Ab-42) antibody produced in rabbit affinity isolated antibody human, mouse
immunohistochemistry, western blot pricing
SAB2101581 Anti-NFKBIA (ab1) antibody produced in rabbit affinity isolated antibody human, pig, sheep, horse, dog, mouse, bovine, rat
western blot pricing
SAB2101582 Anti-NFKBIA (ab2) antibody produced in rabbit affinity isolated antibody pig, human, rat, dog, mouse, bovine, sheep
western blot pricing
AV100940 Anti-NFKBIA antibody produced in rabbit affinity isolated antibody human
immunohistochemistry, western blot pricing
HPA029207 Anti-NFKBIA antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
SAB4301546 Anti-phospho-I κB-α (pTyr305) antibody produced in rabbit affinity isolated antibody human, monkey, mouse, rat
western blot pricing
SAB4504445 Anti-phospho-IkappaB-α (pSer32/36) antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB4504235 Anti-phospho-IkappaB-α (pTyr305) antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, immunohistochemistry, western blot pricing
SAB4504438 Anti-phospho-IkappaB-α (pTyr42) antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, immunohistochemistry pricing
SAB4300125 Anti-phospho-NFKBIA (pSer32/pSer36) antibody produced in rabbit affinity isolated antibody human, mouse
immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020529 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020529 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020529 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010907 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010907 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010907 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020529 Rosetta Predictions human pricing
NM_001105720 Rosetta Predictions rat pricing
NM_010907 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020529 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00118486 predicted 363
2 SASI_Hs02_00353575 predicted 399
3 SASI_Hs01_00118487 predicted 371
4 SASI_Hs01_00118488 predicted 767
5 SASI_Hs01_00118490 predicted 508
6 SASI_Hs01_00118491 predicted 830
7 SASI_Hs01_00118492 predicted 857
8 SASI_Hs01_00118493 predicted 374
9 SASI_Hs01_00118494 predicted 794
10 SASI_Hs01_00118495 predicted 593
11 SASI_Hs01_00118489 predicted 389
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105720 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00211866 predicted 511
2 SASI_Rn02_00211867 predicted 373
3 SASI_Rn02_00211868 predicted 591
4 SASI_Rn02_00211869 predicted 413
5 SASI_Rn02_00211870 predicted 378
6 SASI_Rn02_00211871 predicted 669
7 SASI_Rn02_00211872 predicted 803
8 SASI_Rn02_00211873 predicted 332
9 SASI_Rn02_00211874 predicted 335
10 SASI_Rn02_00211875 predicted 351
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010907 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00040161 predicted 463
2 SASI_Mm01_00040162 predicted 675
3 SASI_Mm02_00319635 predicted 351
4 SASI_Mm01_00040163 predicted 288
5 SASI_Mm01_00040164 predicted 330
6 SASI_Mm01_00040165 predicted 748
7 SASI_Mm01_00040166 predicted 760
8 SASI_Mm01_00040167 predicted 284
9 SASI_Mm01_00040168 predicted 330
10 SASI_Mm01_00040169 predicted 434
11 SASI_Mm01_00040170 predicted 538
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020529
NFKBIA MISSION shRNA Bacterial Glycerol Stock
nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, alpha
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000355914    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020529.2-525s21c1
Sequence:CCGGCTCCGAGACTTTCGAGGAAATCTCGAGATTTCCTCGAAAGTCTCGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355849    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020529.2-1209s21c1
Sequence:CCGGTGGTAGGATCAGCCCTCATTTCTCGAGAAATGAGGGCTGATCCTACCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355850    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020529.2-467s21c1
Sequence:CCGGGATCACCAACCAGCCAGAAATCTCGAGATTTCTGGCTGGTTGGTGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010888    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020529.x-967s1c1
Sequence:CCGGAGAGTCAGAGTTCACGGAGTTCTCGAGAACTCCGTGAACTCTGACTCTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355848    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020529.2-1392s21c1
Sequence:CCGGTGGTATCCTGTGACATGTAACCTCGAGGTTACATGTCACAGGATACCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004542    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020529.x-1241s1c1
Sequence:CCGGGACGAGAAAGATCATTGAAATCTCGAGATTTCAATGATCTTTCTCGTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020529.x-604s1c1
Sequence:CCGGGCACCTCCACTCCATCCTGAACTCGAGTTCAGGATGGAGTGGAGGTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004540    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020529.x-424s1c1
Sequence:CCGGGCAGCAGACTCCACTCCACTTCTCGAGAAGTGGAGTGGAGTCTGCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020529.x-452s1c1
Sequence:CCGGATCACCAACCAGCCAGAAATTCTCGAGAATTTCTGGCTGGTTGGTGATTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020529
NFKBIA MISSION shRNA shRNA Plasmid DNA
nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, alpha
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000355914    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020529.2-525s21c1
Sequence:CCGGCTCCGAGACTTTCGAGGAAATCTCGAGATTTCCTCGAAAGTCTCGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000355849    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020529.2-1209s21c1
Sequence:CCGGTGGTAGGATCAGCCCTCATTTCTCGAGAAATGAGGGCTGATCCTACCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000355850    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020529.2-467s21c1
Sequence:CCGGGATCACCAACCAGCCAGAAATCTCGAGATTTCTGGCTGGTTGGTGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010888    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020529.x-967s1c1
Sequence:CCGGAGAGTCAGAGTTCACGGAGTTCTCGAGAACTCCGTGAACTCTGACTCTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000355848    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020529.2-1392s21c1
Sequence:CCGGTGGTATCCTGTGACATGTAACCTCGAGGTTACATGTCACAGGATACCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000004542    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020529.x-1241s1c1
Sequence:CCGGGACGAGAAAGATCATTGAAATCTCGAGATTTCAATGATCTTTCTCGTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000004541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020529.x-604s1c1
Sequence:CCGGGCACCTCCACTCCATCCTGAACTCGAGTTCAGGATGGAGTGGAGGTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000004540    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020529.x-424s1c1
Sequence:CCGGGCAGCAGACTCCACTCCACTTCTCGAGAAGTGGAGTGGAGTCTGCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000004539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020529.x-452s1c1
Sequence:CCGGATCACCAACCAGCCAGAAATTCTCGAGAATTTCTGGCTGGTTGGTGATTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020529
NFKBIA MISSION shRNA Lentiviral Transduction Particles
nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, alpha
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000355914    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020529.2-525s21c1
Sequence:CCGGCTCCGAGACTTTCGAGGAAATCTCGAGATTTCCTCGAAAGTCTCGGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355849    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020529.2-1209s21c1
Sequence:CCGGTGGTAGGATCAGCCCTCATTTCTCGAGAAATGAGGGCTGATCCTACCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355850    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020529.2-467s21c1
Sequence:CCGGGATCACCAACCAGCCAGAAATCTCGAGATTTCTGGCTGGTTGGTGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010888    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020529.x-967s1c1
Sequence:CCGGAGAGTCAGAGTTCACGGAGTTCTCGAGAACTCCGTGAACTCTGACTCTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355848    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020529.2-1392s21c1
Sequence:CCGGTGGTATCCTGTGACATGTAACCTCGAGGTTACATGTCACAGGATACCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004542    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020529.x-1241s1c1
Sequence:CCGGGACGAGAAAGATCATTGAAATCTCGAGATTTCAATGATCTTTCTCGTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020529.x-604s1c1
Sequence:CCGGGCACCTCCACTCCATCCTGAACTCGAGTTCAGGATGGAGTGGAGGTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004540    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020529.x-424s1c1
Sequence:CCGGGCAGCAGACTCCACTCCACTTCTCGAGAAGTGGAGTGGAGTCTGCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020529.x-452s1c1
Sequence:CCGGATCACCAACCAGCCAGAAATTCTCGAGAATTTCTGGCTGGTTGGTGATTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010907
NFKBIA MISSION shRNA Bacterial Glycerol Stock
nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, alpha
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000319456    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010907.2-1220s21c1
Sequence:CCGGGTGATTCGGCTGTTGTCTTTGCTCGAGCAAAGACAACAGCCGAATCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317722    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010907.2-349s21c1
Sequence:CCGGGTTCCTGCACTTGGCAATCATCTCGAGATGATTGCCAAGTGCAGGAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319455    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010907.2-538s21c1
Sequence:CCGGCCGAGACTTTCGAGGAAATACCTCGAGGTATTTCCTCGAAAGTCTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350015    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010907.2-1045s21c1
Sequence:CCGGAGGCCAGCGTCTGACATTATACTCGAGTATAATGTCAGACGCTGGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319454    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010907.2-235s21c1
Sequence:CCGGGGACGAGGAGTACGAGCAAATCTCGAGATTTGCTCGTACTCCTCGTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096121    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010907.1-939s1c1
Sequence:CCGGGAGTCAGAATTCACAGAGGATCTCGAGATCCTCTGTGAATTCTGACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010907.1-481s1c1
Sequence:CCGGTCCGAGACTTTCGAGGAAATACTCGAGTATTTCCTCGAAAGTCTCGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010907.1-300s1c1
Sequence:CCGGCACTTGGCAATCATCCACGAACTCGAGTTCGTGGATGATTGCCAAGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096122    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010907.1-788s1c1
Sequence:CCGGTGATGTCAACAGGGTAACCTACTCGAGTAGGTTACCCTGTTGACATCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096123    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010907.1-293s1c1
Sequence:CCGGGTTCCTGCACTTGGCAATCATCTCGAGATGATTGCCAAGTGCAGGAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010907
NFKBIA MISSION shRNA shRNA Plasmid DNA
nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, alpha
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000319456    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010907.2-1220s21c1
Sequence:CCGGGTGATTCGGCTGTTGTCTTTGCTCGAGCAAAGACAACAGCCGAATCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000317722    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010907.2-349s21c1
Sequence:CCGGGTTCCTGCACTTGGCAATCATCTCGAGATGATTGCCAAGTGCAGGAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319455    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010907.2-538s21c1
Sequence:CCGGCCGAGACTTTCGAGGAAATACCTCGAGGTATTTCCTCGAAAGTCTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000350015    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010907.2-1045s21c1
Sequence:CCGGAGGCCAGCGTCTGACATTATACTCGAGTATAATGTCAGACGCTGGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319454    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010907.2-235s21c1
Sequence:CCGGGGACGAGGAGTACGAGCAAATCTCGAGATTTGCTCGTACTCCTCGTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096121    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010907.1-939s1c1
Sequence:CCGGGAGTCAGAATTCACAGAGGATCTCGAGATCCTCTGTGAATTCTGACTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010907.1-481s1c1
Sequence:CCGGTCCGAGACTTTCGAGGAAATACTCGAGTATTTCCTCGAAAGTCTCGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010907.1-300s1c1
Sequence:CCGGCACTTGGCAATCATCCACGAACTCGAGTTCGTGGATGATTGCCAAGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096122    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010907.1-788s1c1
Sequence:CCGGTGATGTCAACAGGGTAACCTACTCGAGTAGGTTACCCTGTTGACATCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096123    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010907.1-293s1c1
Sequence:CCGGGTTCCTGCACTTGGCAATCATCTCGAGATGATTGCCAAGTGCAGGAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010907
NFKBIA MISSION shRNA Lentiviral Transduction Particles
nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, alpha
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000319456    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010907.2-1220s21c1
Sequence:CCGGGTGATTCGGCTGTTGTCTTTGCTCGAGCAAAGACAACAGCCGAATCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317722    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010907.2-349s21c1
Sequence:CCGGGTTCCTGCACTTGGCAATCATCTCGAGATGATTGCCAAGTGCAGGAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319455    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010907.2-538s21c1
Sequence:CCGGCCGAGACTTTCGAGGAAATACCTCGAGGTATTTCCTCGAAAGTCTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350015    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010907.2-1045s21c1
Sequence:CCGGAGGCCAGCGTCTGACATTATACTCGAGTATAATGTCAGACGCTGGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319454    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010907.2-235s21c1
Sequence:CCGGGGACGAGGAGTACGAGCAAATCTCGAGATTTGCTCGTACTCCTCGTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096121    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010907.1-939s1c1
Sequence:CCGGGAGTCAGAATTCACAGAGGATCTCGAGATCCTCTGTGAATTCTGACTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010907.1-481s1c1
Sequence:CCGGTCCGAGACTTTCGAGGAAATACTCGAGTATTTCCTCGAAAGTCTCGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010907.1-300s1c1
Sequence:CCGGCACTTGGCAATCATCCACGAACTCGAGTTCGTGGATGATTGCCAAGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096122    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010907.1-788s1c1
Sequence:CCGGTGATGTCAACAGGGTAACCTACTCGAGTAGGTTACCCTGTTGACATCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096123    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010907.1-293s1c1
Sequence:CCGGGTTCCTGCACTTGGCAATCATCTCGAGATGATTGCCAAGTGCAGGAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)