EMAIL THIS PAGE TO A FRIEND

NFKBIB

nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, beta

92 Gene Product Result for
Synonyms: IKBB TRIP9
UniProtKB ID: Q15653, A8K3F4, Q96BJ7
Gene ID:
Human(4793) Summary: The protein encoded by this gene belongs to the NF-kappa-B inhibitor family, which inhibit NF-kappa-B by complexing with, and trapping it in the cytoplasm. Phosphorylation of serine residues on these proteins by kinases marks them for destruction via the ubiquitination pathway, thereby allowing activation of the NF-kappa-B, which translocates to the nucleus to function as a transcription factor. Alternatively spliced transcript variants have been found for this gene.[provided by RefSeq, Jul 2011]
Mouse(18036) nuclear factor of kappa light polypeptide gene enhancer in B cells inhibitor, beta
Rat(81525) nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, beta
chicken(100858419) nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, beta
cow(525408) nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, beta
domestic cat(101099259) nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, beta
dog(484519) nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, beta
naked mole-rat(101717375) nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, beta
domestic guinea pig(100734800) nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, beta
sheep(101113618) nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, beta
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4501996 Anti-IκB-β antibody produced in rabbit affinity isolated antibody human
ELISA, western blot pricing
SAB1101196 Anti-NFKBIB (344-354) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
AV34504 Anti-NFKBIB (AB1) antibody produced in rabbit IgG fraction of antiserum horse, rabbit, human, bovine, rat, canine, mouse, guinea pig
immunohistochemistry, western blot pricing
AV34505 Anti-NFKBIB (AB2) antibody produced in rabbit IgG fraction of antiserum rabbit, horse, guinea pig, bovine, rat, human, mouse, canine
western blot pricing
SAB1411964 ANTI-NFKBIB antibody produced in mouse clone 1B5, purified immunoglobulin, buffered aqueous solution human
ELISA, immunohistochemistry pricing
SAB1412280 ANTI-NFKBIB antibody produced in mouse clone 3B5, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
AV34382 Anti-NFKBIB antibody produced in rabbit affinity isolated antibody horse, mouse, rat, canine, human, bovine, rabbit, guinea pig
western blot pricing
SAB2101583 Anti-NFKBIB antibody produced in rabbit affinity isolated antibody bovine, human, guinea pig, rabbit, canine, rat, mouse, horse
western blot pricing
HPA063734 Anti-NFKBIB antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody human
immunofluorescence, western blot pricing
SAB4503765 Anti-phospho-IkappaB-β (pSer23) antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB4503880 Anti-phospho-IkappaB-β (pThr19) antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, western blot pricing
SAB4301507 Anti-phospho-IκB-β (pThr19) antibody produced in rabbit affinity isolated antibody rat, human, mouse
western blot pricing
SAB4300238 Anti-phospho-NFKBIB (pSer23) antibody produced in rabbit affinity isolated antibody mouse, human, rat
immunohistochemistry pricing
WH0004793M2 Monoclonal Anti-NFKBIB antibody produced in mouse clone 2B11, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1404126 Monoclonal Anti-NFKBIB antibody produced in mouse clone 3E11, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB5300412 Monoclonal Anti-NFKBIB antibody produced in mouse clone 7B4, ascites fluid human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002503 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002503 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002503 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010908 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010908 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010908 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001001716 Rosetta Predictions human pricing
NM_002503 Rosetta Predictions human pricing
NM_030867 Rosetta Predictions rat pricing
NM_010908 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001716 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00153365 predicted 625
2 SASI_Hs01_00153366 predicted 630
3 SASI_Hs02_00303911 predicted 591
4 SASI_Hs01_00153368 predicted 638
5 SASI_Hs01_00153369 predicted 488
6 SASI_Hs01_00153370 predicted 639
7 SASI_Hs01_00153371 predicted 631
8 SASI_Hs01_00153372 predicted 635
9 SASI_Hs01_00153373 predicted 482
10 SASI_Hs01_00153374 predicted 491
11 SASI_Hs01_00153367 predicted 679
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002503 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00115026 predicted 685
2 SASI_Hs01_00115027 predicted 687
3 SASI_Hs02_00333964 predicted 647
4 SASI_Hs01_00115029 predicted 694
5 SASI_Hs01_00115030 predicted 544
6 SASI_Hs01_00115031 predicted 696
7 SASI_Hs01_00115032 predicted 688
8 SASI_Hs01_00115033 predicted 686
9 SASI_Hs01_00115034 predicted 536
10 SASI_Hs01_00115035 predicted 551
11 SASI_Hs01_00115028 predicted 734
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030867 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00069099 predicted 577
2 SASI_Rn01_00069100 predicted 568
3 SASI_Rn01_00069101 predicted 679
4 SASI_Rn01_00069103 predicted 319
5 SASI_Rn01_00069104 predicted 435
6 SASI_Rn01_00069105 predicted 602
7 SASI_Rn01_00069106 predicted 1146
8 SASI_Rn01_00069107 predicted 367
9 SASI_Rn01_00069108 predicted 560
10 SASI_Rn02_00264127 predicted 727
11 SASI_Rn01_00069102 predicted 500
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010908 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00176018 predicted 415
2 SASI_Mm02_00319636 predicted 688
3 SASI_Mm01_00176020 predicted 1538
4 SASI_Mm01_00176022 predicted 1599
5 SASI_Mm01_00176023 predicted 425
6 SASI_Mm01_00176024 predicted 1560
7 SASI_Mm01_00176025 predicted 382
8 SASI_Mm01_00176026 predicted 794
9 SASI_Mm01_00176027 predicted 652
10 SASI_Mm02_00319637 predicted 1574
11 SASI_Mm01_00176019 predicted 1074
12 SASI_Mm01_00176021 predicted 1387
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002503
VALIDATED
NFKBIB MISSION shRNA Bacterial Glycerol Stock
nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, beta
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000318914    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002503.3-607s21c1
Sequence:CCGGCGACTTGGAGAAGGAAGAAGACTCGAGTCTTCTTCCTTCTCCAAGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275156    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002503.3-562s21c1
Sequence:CCGGTACTCCCGACACCAACCATACCTCGAGGTATGGTTGGTGTCGGGAGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275104    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_002503.3-318s21c1
Sequence:CCGGTGGACCTGCAGAATGACCTAGCTCGAGCTAGGTCATTCTGCAGGTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275102    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_002503.3-251s21c1
Sequence:CCGGGCTGTGATTCATCAGCATGAACTCGAGTTCATGCTGATGAATCACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275155    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_002503.3-739s21c1
Sequence:CCGGAGATGCTGGAGCTGACCTTGACTCGAGTCAAGGTCAGCTCCAGCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018556    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_002503.2-227s1c1
Sequence:CCGGGCTGTGATTCATCAGCATGAACTCGAGTTCATGCTGATGAATCACAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018558    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_002503.2-1007s1c1
Sequence:CCGGGAATACGACGACATTGTGGTTCTCGAGAACCACAATGTCGTCGTATTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018560    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_002503.2-791s1c1
Sequence:CCGGGCAGCCGATGTGCTGGAGCTTCTCGAGAAGCTCCAGCACATCGGCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018559    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_002503.2-583s1c1
Sequence:CCGGCGACTTGGAGAAGGAAGAAGACTCGAGTCTTCTTCCTTCTCCAAGTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002503.2-671s1c1
Sequence:CCGGGTGGCCGTTATCCACAAAGATCTCGAGATCTTTGTGGATAACGGCCACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002503
VALIDATED
NFKBIB MISSION shRNA shRNA Plasmid DNA
nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, beta
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000318914    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002503.3-607s21c1
Sequence:CCGGCGACTTGGAGAAGGAAGAAGACTCGAGTCTTCTTCCTTCTCCAAGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275156    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002503.3-562s21c1
Sequence:CCGGTACTCCCGACACCAACCATACCTCGAGGTATGGTTGGTGTCGGGAGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275104    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_002503.3-318s21c1
Sequence:CCGGTGGACCTGCAGAATGACCTAGCTCGAGCTAGGTCATTCTGCAGGTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275102    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_002503.3-251s21c1
Sequence:CCGGGCTGTGATTCATCAGCATGAACTCGAGTTCATGCTGATGAATCACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275155    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_002503.3-739s21c1
Sequence:CCGGAGATGCTGGAGCTGACCTTGACTCGAGTCAAGGTCAGCTCCAGCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018556    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_002503.2-227s1c1
Sequence:CCGGGCTGTGATTCATCAGCATGAACTCGAGTTCATGCTGATGAATCACAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018558    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_002503.2-1007s1c1
Sequence:CCGGGAATACGACGACATTGTGGTTCTCGAGAACCACAATGTCGTCGTATTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018560    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_002503.2-791s1c1
Sequence:CCGGGCAGCCGATGTGCTGGAGCTTCTCGAGAAGCTCCAGCACATCGGCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018559    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_002503.2-583s1c1
Sequence:CCGGCGACTTGGAGAAGGAAGAAGACTCGAGTCTTCTTCCTTCTCCAAGTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002503.2-671s1c1
Sequence:CCGGGTGGCCGTTATCCACAAAGATCTCGAGATCTTTGTGGATAACGGCCACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002503
VALIDATED
NFKBIB MISSION shRNA Lentiviral Transduction Particles
nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, beta
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000318914    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002503.3-607s21c1
Sequence:CCGGCGACTTGGAGAAGGAAGAAGACTCGAGTCTTCTTCCTTCTCCAAGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275156    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002503.3-562s21c1
Sequence:CCGGTACTCCCGACACCAACCATACCTCGAGGTATGGTTGGTGTCGGGAGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275104    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_002503.3-318s21c1
Sequence:CCGGTGGACCTGCAGAATGACCTAGCTCGAGCTAGGTCATTCTGCAGGTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275102    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_002503.3-251s21c1
Sequence:CCGGGCTGTGATTCATCAGCATGAACTCGAGTTCATGCTGATGAATCACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275155    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_002503.3-739s21c1
Sequence:CCGGAGATGCTGGAGCTGACCTTGACTCGAGTCAAGGTCAGCTCCAGCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018556    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_002503.2-227s1c1
Sequence:CCGGGCTGTGATTCATCAGCATGAACTCGAGTTCATGCTGATGAATCACAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018558    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_002503.2-1007s1c1
Sequence:CCGGGAATACGACGACATTGTGGTTCTCGAGAACCACAATGTCGTCGTATTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018560    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_002503.2-791s1c1
Sequence:CCGGGCAGCCGATGTGCTGGAGCTTCTCGAGAAGCTCCAGCACATCGGCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018559    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_002503.2-583s1c1
Sequence:CCGGCGACTTGGAGAAGGAAGAAGACTCGAGTCTTCTTCCTTCTCCAAGTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002503.2-671s1c1
Sequence:CCGGGTGGCCGTTATCCACAAAGATCTCGAGATCTTTGTGGATAACGGCCACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010908
VALIDATED
NFKBIB MISSION shRNA Bacterial Glycerol Stock
nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, beta
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000304902    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010908.4-1068s21c1
Sequence:CCGGCAGAGATGAGGGCGATGAATACTCGAGTATTCATCGCCCTCATCTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304842    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010908.4-425s21c1
Sequence:CCGGCTACAGTAGAGAAGTTGTATGCTCGAGCATACAACTTCTCTACTGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304903    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010908.4-1590s21c1
Sequence:CCGGAGCAGCTCTGCCACTTCATATCTCGAGATATGAAGTGGCAGAGCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316391    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010908.4-1144s21c1
Sequence:CCGGGCATCCAAACCTCTTCCTGATCTCGAGATCAGGAAGAGGTTTGGATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316392    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010908.4-797s21c1
Sequence:CCGGACCTCAATAAACCGGAGCCTACTCGAGTAGGCTCCGGTTTATTGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095089    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010908.3-1658s1c1
Sequence:CCGGCCACCATCCTTGCTTCTACAACTCGAGTTGTAGAAGCAAGGATGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095090    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010908.3-797s1c1
Sequence:CCGGACCTCAATAAACCGGAGCCTACTCGAGTAGGCTCCGGTTTATTGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095092    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010908.3-1144s1c1
Sequence:CCGGGCATCCAAACCTCTTCCTGATCTCGAGATCAGGAAGAGGTTTGGATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095093    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010908.3-735s1c1
Sequence:CCGGCCATGTAGCTGTCATCCACAACTCGAGTTGTGGATGACAGCTACATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010908.3-245s1c1
Sequence:CCGGCCTTAGTCTTTGGCTACGTCACTCGAGTGACGTAGCCAAAGACTAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010908
VALIDATED
NFKBIB MISSION shRNA shRNA Plasmid DNA
nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, beta
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000304902    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010908.4-1068s21c1
Sequence:CCGGCAGAGATGAGGGCGATGAATACTCGAGTATTCATCGCCCTCATCTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304842    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010908.4-425s21c1
Sequence:CCGGCTACAGTAGAGAAGTTGTATGCTCGAGCATACAACTTCTCTACTGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304903    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010908.4-1590s21c1
Sequence:CCGGAGCAGCTCTGCCACTTCATATCTCGAGATATGAAGTGGCAGAGCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000316391    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010908.4-1144s21c1
Sequence:CCGGGCATCCAAACCTCTTCCTGATCTCGAGATCAGGAAGAGGTTTGGATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000316392    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010908.4-797s21c1
Sequence:CCGGACCTCAATAAACCGGAGCCTACTCGAGTAGGCTCCGGTTTATTGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000095089    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010908.3-1658s1c1
Sequence:CCGGCCACCATCCTTGCTTCTACAACTCGAGTTGTAGAAGCAAGGATGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000095090    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010908.3-797s1c1
Sequence:CCGGACCTCAATAAACCGGAGCCTACTCGAGTAGGCTCCGGTTTATTGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000095092    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010908.3-1144s1c1
Sequence:CCGGGCATCCAAACCTCTTCCTGATCTCGAGATCAGGAAGAGGTTTGGATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000095093    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010908.3-735s1c1
Sequence:CCGGCCATGTAGCTGTCATCCACAACTCGAGTTGTGGATGACAGCTACATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000095091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010908.3-245s1c1
Sequence:CCGGCCTTAGTCTTTGGCTACGTCACTCGAGTGACGTAGCCAAAGACTAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010908
VALIDATED
NFKBIB MISSION shRNA Lentiviral Transduction Particles
nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, beta
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000304902    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010908.4-1068s21c1
Sequence:CCGGCAGAGATGAGGGCGATGAATACTCGAGTATTCATCGCCCTCATCTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304842    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010908.4-425s21c1
Sequence:CCGGCTACAGTAGAGAAGTTGTATGCTCGAGCATACAACTTCTCTACTGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304903    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010908.4-1590s21c1
Sequence:CCGGAGCAGCTCTGCCACTTCATATCTCGAGATATGAAGTGGCAGAGCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316391    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010908.4-1144s21c1
Sequence:CCGGGCATCCAAACCTCTTCCTGATCTCGAGATCAGGAAGAGGTTTGGATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316392    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010908.4-797s21c1
Sequence:CCGGACCTCAATAAACCGGAGCCTACTCGAGTAGGCTCCGGTTTATTGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095089    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010908.3-1658s1c1
Sequence:CCGGCCACCATCCTTGCTTCTACAACTCGAGTTGTAGAAGCAAGGATGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095090    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010908.3-797s1c1
Sequence:CCGGACCTCAATAAACCGGAGCCTACTCGAGTAGGCTCCGGTTTATTGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095092    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010908.3-1144s1c1
Sequence:CCGGGCATCCAAACCTCTTCCTGATCTCGAGATCAGGAAGAGGTTTGGATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095093    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010908.3-735s1c1
Sequence:CCGGCCATGTAGCTGTCATCCACAACTCGAGTTGTGGATGACAGCTACATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010908.3-245s1c1
Sequence:CCGGCCTTAGTCTTTGGCTACGTCACTCGAGTGACGTAGCCAAAGACTAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)