EMAIL THIS PAGE TO A FRIEND

NFKBID

nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, delta

73 Gene Product Result for
Synonyms: IkappaBNS TA-NFKBH
UniProtKB ID: Q8NI38, Q8NI39, Q9BRG9
Gene ID:
Mouse(243910) nuclear factor of kappa light polypeptide gene enhancer in B cells inhibitor, delta
Rat(308496) nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, delta
sheep(101104928) nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, delta
domestic guinea pig(100713458) nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, delta
naked mole-rat(101707156) nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, delta
chicken(428243) nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, delta
cow(614198) nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, delta
domestic cat(101087118) nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, delta
dog(484569) nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, delta
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1303384 ANTI-NFKBID (N-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution mouse
immunohistochemistry, western blot pricing
SAB2107558 Anti-NFKBID antibody produced in rabbit affinity isolated antibody human, horse, rabbit, guinea pig
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032721 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032721 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032721 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172142 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172142 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172142 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_139239 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_139239 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_139239 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU139741 MISSION® esiRNA esiRNA human NFKBID (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_139239 Rosetta Predictions human pricing
XM_001079086 Rosetta Predictions rat pricing
XM_218484 Rosetta Predictions rat pricing
NM_172142 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139239 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00063616 predicted 664
2 SASI_Hs02_00364240 predicted 962
3 SASI_Hs01_00063617 predicted 994
4 SASI_Hs01_00063618 predicted 1140
5 SASI_Hs01_00063619 predicted 1586
6 SASI_Hs01_00063621 predicted 1121
7 SASI_Hs01_00063622 predicted 796
8 SASI_Hs01_00063623 predicted 1050
9 SASI_Hs01_00063624 predicted 1172
10 SASI_Hs01_00063625 predicted 963
11 SASI_Hs01_00063620 predicted 867
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001079086 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00363121 predicted 990
2 SASI_Rn02_00363122 predicted 200
3 SASI_Rn02_00363123 predicted 484
4 SASI_Rn02_00363124 predicted 791
5 SASI_Rn02_00363125 predicted 802
6 SASI_Rn02_00363126 predicted 455
7 SASI_Rn02_00363127 predicted 1147
8 SASI_Rn02_00363128 predicted 1120
9 SASI_Rn02_00363129 predicted 1060
10 SASI_Rn02_00363130 predicted 819
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_218484 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00377793 predicted 1025
2 SASI_Rn02_00377794 predicted 1160
3 SASI_Rn02_00377795 predicted 1190
4 SASI_Rn02_00377796 predicted 1182
5 SASI_Rn02_00377797 predicted 1222
6 SASI_Rn02_00377798 predicted 1011
7 SASI_Rn02_00377799 predicted 1651
8 SASI_Rn02_00377800 predicted 1111
9 SASI_Rn02_00377801 predicted 1625
10 SASI_Rn02_00377802 predicted 1790
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172142 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00113205 predicted 930
2 SASI_Mm01_00113206 predicted 732
3 SASI_Mm01_00113207 predicted 1504
4 SASI_Mm01_00113208 predicted 1514
5 SASI_Mm01_00113209 predicted 735
6 SASI_Mm01_00113210 predicted 1289
7 SASI_Mm01_00113211 predicted 1092
8 SASI_Mm02_00343680 predicted 477
9 SASI_Mm02_00343681 predicted 1525
10 SASI_Mm02_00343682 predicted 951
11 SASI_Mm01_00113212 predicted 1065
12 SASI_Mm01_00113213 predicted 1125
13 SASI_Mm01_00113214 predicted 1127
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032721
NFKBID MISSION shRNA Bacterial Glycerol Stock
nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, delta
Human
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000168078    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032721.2-1094s1c1
Sequence:CCGGCAACAAGACAGTTCTGCACTTCTCGAGAAGTGCAGAACTGTCTTGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172840    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032721.2-1093s1c1
Sequence:CCGGGCAACAAGACAGTTCTGCACTCTCGAGAGTGCAGAACTGTCTTGTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172487    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032721.2-713s1c1
Sequence:CCGGCATTCGTGAGCATAAGGGCAACTCGAGTTGCCCTTATGCTCACGAATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032721
NFKBID MISSION shRNA shRNA Plasmid DNA
nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, delta
Human
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000168078    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032721.2-1094s1c1
Sequence:CCGGCAACAAGACAGTTCTGCACTTCTCGAGAAGTGCAGAACTGTCTTGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000172840    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032721.2-1093s1c1
Sequence:CCGGGCAACAAGACAGTTCTGCACTCTCGAGAGTGCAGAACTGTCTTGTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000172487    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032721.2-713s1c1
Sequence:CCGGCATTCGTGAGCATAAGGGCAACTCGAGTTGCCCTTATGCTCACGAATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032721
NFKBID MISSION shRNA Lentiviral Transduction Particles
nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, delta
Human
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000168078    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032721.2-1094s1c1
Sequence:CCGGCAACAAGACAGTTCTGCACTTCTCGAGAAGTGCAGAACTGTCTTGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172840    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032721.2-1093s1c1
Sequence:CCGGGCAACAAGACAGTTCTGCACTCTCGAGAGTGCAGAACTGTCTTGTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172487    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032721.2-713s1c1
Sequence:CCGGCATTCGTGAGCATAAGGGCAACTCGAGTTGCCCTTATGCTCACGAATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172142
NFKBID MISSION shRNA Bacterial Glycerol Stock
nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, delta
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000196068    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172142.1-920s1c1
Sequence:CCGGGCTGTGTTTAAGTCCGGCATTCTCGAGAATGCCGGACTTAAACACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000258109    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172142.3-593s21c1
Sequence:CCGGGACAGCCCGAGCTCACATATTCTCGAGAATATGTGAGCTCGGGCTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216067    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_172142.3-1558s1c1
Sequence:CCGGCCATTAGGGTCTTACATTAAACTCGAGTTTAATGTAAGACCCTAATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250815    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172142.3-1066s21c1
Sequence:CCGGTGACTTGTGTGCAGATGTTACCTCGAGGTAACATCTGCACACAAGTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250816    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172142.3-730s21c1
Sequence:CCGGTGTACCGACAGCTGGATATTCCTCGAGGAATATCCAGCTGTCGGTACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250817    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172142.3-1521s21c1
Sequence:CCGGTGTCGCAGATTCATGATAATACTCGAGTATTATCATGAATCTGCGACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172142
NFKBID MISSION shRNA shRNA Plasmid DNA
nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, delta
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000196068    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172142.1-920s1c1
Sequence:CCGGGCTGTGTTTAAGTCCGGCATTCTCGAGAATGCCGGACTTAAACACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000258109    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172142.3-593s21c1
Sequence:CCGGGACAGCCCGAGCTCACATATTCTCGAGAATATGTGAGCTCGGGCTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216067    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_172142.3-1558s1c1
Sequence:CCGGCCATTAGGGTCTTACATTAAACTCGAGTTTAATGTAAGACCCTAATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250815    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172142.3-1066s21c1
Sequence:CCGGTGACTTGTGTGCAGATGTTACCTCGAGGTAACATCTGCACACAAGTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250816    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172142.3-730s21c1
Sequence:CCGGTGTACCGACAGCTGGATATTCCTCGAGGAATATCCAGCTGTCGGTACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250817    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172142.3-1521s21c1
Sequence:CCGGTGTCGCAGATTCATGATAATACTCGAGTATTATCATGAATCTGCGACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172142
NFKBID MISSION shRNA Lentiviral Transduction Particles
nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, delta
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000196068    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172142.1-920s1c1
Sequence:CCGGGCTGTGTTTAAGTCCGGCATTCTCGAGAATGCCGGACTTAAACACAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000258109    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172142.3-593s21c1
Sequence:CCGGGACAGCCCGAGCTCACATATTCTCGAGAATATGTGAGCTCGGGCTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216067    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_172142.3-1558s1c1
Sequence:CCGGCCATTAGGGTCTTACATTAAACTCGAGTTTAATGTAAGACCCTAATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250815    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172142.3-1066s21c1
Sequence:CCGGTGACTTGTGTGCAGATGTTACCTCGAGGTAACATCTGCACACAAGTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250816    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172142.3-730s21c1
Sequence:CCGGTGTACCGACAGCTGGATATTCCTCGAGGAATATCCAGCTGTCGGTACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250817    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172142.3-1521s21c1
Sequence:CCGGTGTCGCAGATTCATGATAATACTCGAGTATTATCATGAATCTGCGACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_139239
NFKBID MISSION shRNA Bacterial Glycerol Stock
nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, delta
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000245657    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139239.1-795s21c1
Sequence:CCGGTGTACCGGCGTCTTGACATTCCTCGAGGAATGTCAAGACGCCGGTACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245659    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139239.1-1149s21c1
Sequence:CCGGTGCTGCAAATGGGTGCTAATCCTCGAGGATTAGCACCCATTTGCAGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245658    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_139239.1-1585s21c1
Sequence:CCGGATGTTGCAAACCCATGATAATCTCGAGATTATCATGGGTTTGCAACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245656    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139239.1-1505s21c1
Sequence:CCGGCTGTCCTCTTAGGACTCAAACCTCGAGGTTTGAGTCCTAAGAGGACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_139239
NFKBID MISSION shRNA shRNA Plasmid DNA
nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, delta
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000245657    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139239.1-795s21c1
Sequence:CCGGTGTACCGGCGTCTTGACATTCCTCGAGGAATGTCAAGACGCCGGTACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245659    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139239.1-1149s21c1
Sequence:CCGGTGCTGCAAATGGGTGCTAATCCTCGAGGATTAGCACCCATTTGCAGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245658    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_139239.1-1585s21c1
Sequence:CCGGATGTTGCAAACCCATGATAATCTCGAGATTATCATGGGTTTGCAACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245656    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139239.1-1505s21c1
Sequence:CCGGCTGTCCTCTTAGGACTCAAACCTCGAGGTTTGAGTCCTAAGAGGACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_139239
NFKBID MISSION shRNA Lentiviral Transduction Particles
nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, delta
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000245657    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139239.1-795s21c1
Sequence:CCGGTGTACCGGCGTCTTGACATTCCTCGAGGAATGTCAAGACGCCGGTACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245659    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139239.1-1149s21c1
Sequence:CCGGTGCTGCAAATGGGTGCTAATCCTCGAGGATTAGCACCCATTTGCAGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245658    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_139239.1-1585s21c1
Sequence:CCGGATGTTGCAAACCCATGATAATCTCGAGATTATCATGGGTTTGCAACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245656    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139239.1-1505s21c1
Sequence:CCGGCTGTCCTCTTAGGACTCAAACCTCGAGGTTTGAGTCCTAAGAGGACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)