EMAIL THIS PAGE TO A FRIEND

NFKBIL1

nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor-like 1

65 Gene Product Result for
Synonyms: IKBL LST1 NFKBIL
Gene ID:
Human(4795) Summary: This gene encodes a divergent member of the I-kappa-B family of proteins. Its function has not been determined. The gene lies within the major histocompatibility complex (MHC) class I region on chromosome 6. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2009]
Mouse(18038) nuclear factor of kappa light polypeptide gene enhancer in B cells inhibitor like 1
Rat(361794) nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor-like 1
Goat(100861323) nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor-like 1
sheep(101104353) nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor-like 1
domestic guinea pig(100723108) nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor-like 1
naked mole-rat(101719126) nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor-like 1
Zebrafish(101056719) nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor-like 1
dog(481711) nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor-like 1
domestic cat(101084284) nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor-like 1
cow(514369) nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor-like 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005007 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005007 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005007 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010909 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010909 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010909 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU108791 MISSION® esiRNA esiRNA human AL662847.6-201 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005007 Rosetta Predictions human pricing
NM_212509 Rosetta Predictions rat pricing
NM_010909 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005007 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00091135 predicted 594
2 SASI_Hs01_00091136 predicted 1174
3 SASI_Hs01_00091137 predicted 1082
4 SASI_Hs01_00091138 predicted 1207
5 SASI_Hs01_00091139 predicted 419
6 SASI_Hs01_00091140 predicted 1229
7 SASI_Hs01_00091141 predicted 431
8 SASI_Hs01_00091142 predicted 1150
9 SASI_Hs01_00091143 predicted 1236
10 SASI_Hs01_00091144 predicted 1136
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_212509 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00035119 predicted 872
2 SASI_Rn01_00035120 predicted 436
3 SASI_Rn01_00035121 predicted 483
4 SASI_Rn01_00035123 predicted 1189
5 SASI_Rn01_00035124 predicted 1151
6 SASI_Rn01_00035125 predicted 212
7 SASI_Rn01_00035126 predicted 267
8 SASI_Rn01_00035127 predicted 593
9 SASI_Rn02_00270504 predicted 443
10 SASI_Rn01_00035128 predicted 1088
11 SASI_Rn01_00035122 predicted 605
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010909 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00111313 predicted 868
2 SASI_Mm01_00111314 predicted 601
3 SASI_Mm01_00111315 predicted 1188
4 SASI_Mm01_00111316 predicted 440
5 SASI_Mm02_00319638 predicted 462
6 SASI_Mm01_00111317 predicted 1219
7 SASI_Mm02_00319639 predicted 1101
8 SASI_Mm01_00111319 predicted 1242
9 SASI_Mm01_00111320 predicted 447
10 SASI_Mm02_00319640 predicted 269
11 SASI_Mm01_00111318 predicted 1241
12 SASI_Mm01_00111321 predicted 1207
13 SASI_Mm01_00111322 predicted 1257
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005007
NFKBIL1 MISSION shRNA Bacterial Glycerol Stock
nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor-like 1
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000056813    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005007.2-430s1c1
Sequence:CCGGAGATGCCTACACCGATTTCTTCTCGAGAAGAAATCGGTGTAGGCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005007.2-202s1c1
Sequence:CCGGACGTCGCTTTCGTCGTTACTTCTCGAGAAGTAACGACGAAAGCGACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005007.2-475s1c1
Sequence:CCGGCTCCGCCATGGGAATAAAGAACTCGAGTTCTTTATTCCCATGGCGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005007.2-662s1c1
Sequence:CCGGGCCTCCCATGAAACCCAGGAACTCGAGTTCCTGGGTTTCATGGGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005007
NFKBIL1 MISSION shRNA shRNA Plasmid DNA
nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor-like 1
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000056813    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005007.2-430s1c1
Sequence:CCGGAGATGCCTACACCGATTTCTTCTCGAGAAGAAATCGGTGTAGGCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005007.2-202s1c1
Sequence:CCGGACGTCGCTTTCGTCGTTACTTCTCGAGAAGTAACGACGAAAGCGACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005007.2-475s1c1
Sequence:CCGGCTCCGCCATGGGAATAAAGAACTCGAGTTCTTTATTCCCATGGCGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005007.2-662s1c1
Sequence:CCGGGCCTCCCATGAAACCCAGGAACTCGAGTTCCTGGGTTTCATGGGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005007
NFKBIL1 MISSION shRNA Lentiviral Transduction Particles
nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor-like 1
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000056813    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005007.2-430s1c1
Sequence:CCGGAGATGCCTACACCGATTTCTTCTCGAGAAGAAATCGGTGTAGGCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005007.2-202s1c1
Sequence:CCGGACGTCGCTTTCGTCGTTACTTCTCGAGAAGTAACGACGAAAGCGACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005007.2-475s1c1
Sequence:CCGGCTCCGCCATGGGAATAAAGAACTCGAGTTCTTTATTCCCATGGCGGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005007.2-662s1c1
Sequence:CCGGGCCTCCCATGAAACCCAGGAACTCGAGTTCCTGGGTTTCATGGGAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010909
NFKBIL1 MISSION shRNA Bacterial Glycerol Stock
nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor-like 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000067508    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010909.1-1298s1c1
Sequence:CCGGCTCAAGAATAGACGGAAGGAACTCGAGTTCCTTCCGTCTATTCTTGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067509    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010909.1-448s1c1
Sequence:CCGGTGATGCTTACACGGACTTCTTCTCGAGAAGAAGTCCGTGTAAGCATCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067510    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010909.1-1156s1c1
Sequence:CCGGGCAGCGATTCCGAAGCCAGATCTCGAGATCTGGCTTCGGAATCGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374213    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010909.4-1103s21c1
Sequence:CCGGAGGTACTTGAGAGTCCAACAGCTCGAGCTGTTGGACTCTCAAGTACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374214    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010909.4-905s21c1
Sequence:CCGGCAAGAGGCTCAACGGGACAAACTCGAGTTTGTCCCGTTGAGCCTCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365865    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010909.4-1152s21c1
Sequence:CCGGAGCGATTCCGAAGCCAGATTGCTCGAGCAATCTGGCTTCGGAATCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365864    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010909.4-1248s21c1
Sequence:CCGGTCAAGTGACCCTAGGGAATAACTCGAGTTATTCCCTAGGGTCACTTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365940    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010909.4-586s21c1
Sequence:CCGGAGTTTCCAAGGAGCGGGAATGCTCGAGCATTCCCGCTCCTTGGAAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010909
NFKBIL1 MISSION shRNA shRNA Plasmid DNA
nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor-like 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000067508    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010909.1-1298s1c1
Sequence:CCGGCTCAAGAATAGACGGAAGGAACTCGAGTTCCTTCCGTCTATTCTTGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067509    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010909.1-448s1c1
Sequence:CCGGTGATGCTTACACGGACTTCTTCTCGAGAAGAAGTCCGTGTAAGCATCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067510    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010909.1-1156s1c1
Sequence:CCGGGCAGCGATTCCGAAGCCAGATCTCGAGATCTGGCTTCGGAATCGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000374213    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010909.4-1103s21c1
Sequence:CCGGAGGTACTTGAGAGTCCAACAGCTCGAGCTGTTGGACTCTCAAGTACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000374214    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010909.4-905s21c1
Sequence:CCGGCAAGAGGCTCAACGGGACAAACTCGAGTTTGTCCCGTTGAGCCTCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365865    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010909.4-1152s21c1
Sequence:CCGGAGCGATTCCGAAGCCAGATTGCTCGAGCAATCTGGCTTCGGAATCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365864    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010909.4-1248s21c1
Sequence:CCGGTCAAGTGACCCTAGGGAATAACTCGAGTTATTCCCTAGGGTCACTTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365940    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010909.4-586s21c1
Sequence:CCGGAGTTTCCAAGGAGCGGGAATGCTCGAGCATTCCCGCTCCTTGGAAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010909
NFKBIL1 MISSION shRNA Lentiviral Transduction Particles
nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor-like 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000067508    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010909.1-1298s1c1
Sequence:CCGGCTCAAGAATAGACGGAAGGAACTCGAGTTCCTTCCGTCTATTCTTGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067509    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010909.1-448s1c1
Sequence:CCGGTGATGCTTACACGGACTTCTTCTCGAGAAGAAGTCCGTGTAAGCATCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067510    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010909.1-1156s1c1
Sequence:CCGGGCAGCGATTCCGAAGCCAGATCTCGAGATCTGGCTTCGGAATCGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374213    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010909.4-1103s21c1
Sequence:CCGGAGGTACTTGAGAGTCCAACAGCTCGAGCTGTTGGACTCTCAAGTACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374214    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010909.4-905s21c1
Sequence:CCGGCAAGAGGCTCAACGGGACAAACTCGAGTTTGTCCCGTTGAGCCTCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365865    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010909.4-1152s21c1
Sequence:CCGGAGCGATTCCGAAGCCAGATTGCTCGAGCAATCTGGCTTCGGAATCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365864    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010909.4-1248s21c1
Sequence:CCGGTCAAGTGACCCTAGGGAATAACTCGAGTTATTCCCTAGGGTCACTTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365940    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010909.4-586s21c1
Sequence:CCGGAGTTTCCAAGGAGCGGGAATGCTCGAGCATTCCCGCTCCTTGGAAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)