EMAIL THIS PAGE TO A FRIEND

NFKBIZ

nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, zeta

121 Gene Product Result for
Synonyms: IKBZ INAP MAIL
UniProtKB ID: Q9BYH8, B3KNR2, D3DN54, Q8IUL4, Q8NAZ8
Gene ID:
Human(64332) Summary: This gene is a member of the ankyrin-repeat family and is induced by lipopolysaccharide (LPS). The C-terminal portion of the encoded product which contains the ankyrin repeats, shares high sequence similarity with the I kappa B family of proteins. The latter are known to play a role in inflammatory responses to LPS by their interaction with NF-B proteins through ankyrin-repeat domains. Studies in mouse indicate that this gene product is one of the nuclear I kappa B proteins and an activator of IL-6 production. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(80859) nuclear factor of kappa light polypeptide gene enhancer in B cells inhibitor, zeta
Rat(304005) nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, zeta
Zebrafish(100001781) nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, zeta
cow(282713) nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, zeta
domestic cat(101096093) nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, zeta
Horse(100034245) nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, zeta
dog(478549) nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, zeta
chicken(418404) nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, zeta
naked mole-rat(101724012) nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, zeta
Domestic Rabbit(100356473) nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, zeta
domestic guinea pig(100717462) nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, zeta
sheep(101113187) nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, zeta
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_030612 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_030612 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_030612 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_031419 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_031419 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_031419 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU060561 MISSION® esiRNA esiRNA human NFKBIZ (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001005474 Rosetta Predictions human pricing
NM_031419 Rosetta Predictions human pricing
NM_001107095 Rosetta Predictions rat pricing
NM_030612 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005474 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00067236 predicted 1182
2 SASI_Hs01_00067237 predicted 2009
3 SASI_Hs01_00067238 predicted 2109
4 SASI_Hs01_00067239 predicted 1566
5 SASI_Hs01_00067240 predicted 748
6 SASI_Hs01_00067241 predicted 1579
7 SASI_Hs01_00067242 predicted 1737
8 SASI_Hs01_00067243 predicted 1929
9 SASI_Hs01_00067244 predicted 1358
10 SASI_Hs02_00304941 predicted 917
11 SASI_Hs01_00067235 predicted 988
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031419 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00148836 predicted 1343
2 SASI_Hs01_00148837 predicted 2167
3 SASI_Hs01_00148838 predicted 2259
4 SASI_Hs01_00148839 predicted 1721
5 SASI_Hs01_00148840 predicted 903
6 SASI_Hs01_00148841 predicted 1728
7 SASI_Hs01_00148842 predicted 1892
8 SASI_Hs01_00148843 predicted 2088
9 SASI_Hs01_00148844 predicted 1516
10 SASI_Hs02_00358805 predicted 1074
11 SASI_Hs01_00148835 predicted 1152
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107095 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00225446 predicted 1757
2 SASI_Rn02_00225447 predicted 1286
3 SASI_Rn02_00225448 predicted 1630
4 SASI_Rn02_00225449 predicted 1564
5 SASI_Rn02_00225450 predicted 1741
6 SASI_Rn02_00225451 predicted 1655
7 SASI_Rn02_00225452 predicted 863
8 SASI_Rn02_00225453 predicted 1428
9 SASI_Rn02_00225454 predicted 1742
10 SASI_Rn02_00225455 predicted 1598
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030612 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00336808 predicted 2177
2 SASI_Mm01_00096808 predicted 2312
3 SASI_Mm01_00096809 predicted 2778
4 SASI_Mm01_00096810 predicted 2605
5 SASI_Mm01_00096812 predicted 1311
6 SASI_Mm01_00096813 predicted 1882
7 SASI_Mm01_00096814 predicted 2415
8 SASI_Mm01_00096815 predicted 1596
9 SASI_Mm01_00096816 predicted 2169
10 SASI_Mm01_00096817 predicted 1081
11 SASI_Mm01_00096811 predicted 2777
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030612
NFKBIZ MISSION shRNA Bacterial Glycerol Stock
nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, zeta
Mouse
18 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000360678    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030612.3-990s21c1
Sequence:CCGGGTGCAACCCAGTTTCACTAAACTCGAGTTTAGTGAAACTGGGTTGCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360605    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030612.3-2400s21c1
Sequence:CCGGGAATGAACAGCCCGTGCATTTCTCGAGAAATGCACGGGCTGTTCATTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030612.3-721s21c1
Sequence:CCGGCAGCCCGTGGATGAGTTTAAGCTCGAGCTTAAACTCATCCACGGGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030612.1-1962s1c1
Sequence:CCGGGCTCTTCACATGCTGGACATTCTCGAGAATGTCCAGCATGTGAAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081758    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030612.1-2766s1c1
Sequence:CCGGCCCTGATGTATCTGTAACATACTCGAGTATGTTACAGATACATCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030612.1-1167s1c1
Sequence:CCGGGCCCTGCTTCAGAATATTATACTCGAGTATAATATTCTGAAGCAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030612.1-1367s1c1
Sequence:CCGGCCAGGCGTCAATGTACCAGTACTCGAGTACTGGTACATTGACGCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030612.1-2424s1c1
Sequence:CCGGGAAGCAAATCTGGAACTCATTCTCGAGAATGAGTTCCAGATTTGCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244369    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030612.2-1368s21c1
Sequence:CCGGAGGCGTCAATGTACCAGTATTCTCGAGAATACTGGTACATTGACGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244368    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030612.2-2833s21c1
Sequence:CCGGACCCATTTAGTTCACTATTATCTCGAGATAATAGTGAACTAAATGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244367    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030612.2-2187s21c1
Sequence:CCGGATCTTGAGGCAACGAACTATGCTCGAGCATAGTTCGTTGCCTCAAGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244366    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030612.2-1764s21c1
Sequence:CCGGTCATGGGAAGCCCGATGAATACTCGAGTATTCATCGGGCTTCCCATGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244365    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030612.2-2323s21c1
Sequence:CCGGGAGCCTGGTAGACACCATTAACTCGAGTTAATGGTGTCTACCAGGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360609    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030612.3-2710s21c1
Sequence:CCGGCCAGGTATCTGGGATCTATATCTCGAGATATAGATCCCAGATACCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030612.3-1290s21c1
Sequence:CCGGCCAGTCTCCCAAGTATGATTCCTCGAGGAATCATACTTGGGAGACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360606    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030612.3-1828s21c1
Sequence:CCGGATTGTGCAAGATCTGGTAAACCTCGAGGTTTACCAGATCTTGCACAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360677    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030612.3-1952s21c1
Sequence:CCGGCTGTGAGGAGCAATCAGTTTGCTCGAGCAAACTGATTGCTCCTCACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360672    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030612.3-2684s21c1
Sequence:CCGGTCTTGGCAGATTTGCGTATTTCTCGAGAAATACGCAAATCTGCCAAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030612
NFKBIZ MISSION shRNA shRNA Plasmid DNA
nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, zeta
Mouse
18 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000360678    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030612.3-990s21c1
Sequence:CCGGGTGCAACCCAGTTTCACTAAACTCGAGTTTAGTGAAACTGGGTTGCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360605    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030612.3-2400s21c1
Sequence:CCGGGAATGAACAGCCCGTGCATTTCTCGAGAAATGCACGGGCTGTTCATTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030612.3-721s21c1
Sequence:CCGGCAGCCCGTGGATGAGTTTAAGCTCGAGCTTAAACTCATCCACGGGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030612.1-1962s1c1
Sequence:CCGGGCTCTTCACATGCTGGACATTCTCGAGAATGTCCAGCATGTGAAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081758    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030612.1-2766s1c1
Sequence:CCGGCCCTGATGTATCTGTAACATACTCGAGTATGTTACAGATACATCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030612.1-1167s1c1
Sequence:CCGGGCCCTGCTTCAGAATATTATACTCGAGTATAATATTCTGAAGCAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030612.1-1367s1c1
Sequence:CCGGCCAGGCGTCAATGTACCAGTACTCGAGTACTGGTACATTGACGCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030612.1-2424s1c1
Sequence:CCGGGAAGCAAATCTGGAACTCATTCTCGAGAATGAGTTCCAGATTTGCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244369    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030612.2-1368s21c1
Sequence:CCGGAGGCGTCAATGTACCAGTATTCTCGAGAATACTGGTACATTGACGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244368    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030612.2-2833s21c1
Sequence:CCGGACCCATTTAGTTCACTATTATCTCGAGATAATAGTGAACTAAATGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244367    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030612.2-2187s21c1
Sequence:CCGGATCTTGAGGCAACGAACTATGCTCGAGCATAGTTCGTTGCCTCAAGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244366    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030612.2-1764s21c1
Sequence:CCGGTCATGGGAAGCCCGATGAATACTCGAGTATTCATCGGGCTTCCCATGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244365    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030612.2-2323s21c1
Sequence:CCGGGAGCCTGGTAGACACCATTAACTCGAGTTAATGGTGTCTACCAGGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360609    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030612.3-2710s21c1
Sequence:CCGGCCAGGTATCTGGGATCTATATCTCGAGATATAGATCCCAGATACCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030612.3-1290s21c1
Sequence:CCGGCCAGTCTCCCAAGTATGATTCCTCGAGGAATCATACTTGGGAGACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360606    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030612.3-1828s21c1
Sequence:CCGGATTGTGCAAGATCTGGTAAACCTCGAGGTTTACCAGATCTTGCACAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360677    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030612.3-1952s21c1
Sequence:CCGGCTGTGAGGAGCAATCAGTTTGCTCGAGCAAACTGATTGCTCCTCACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360672    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030612.3-2684s21c1
Sequence:CCGGTCTTGGCAGATTTGCGTATTTCTCGAGAAATACGCAAATCTGCCAAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030612
NFKBIZ MISSION shRNA Lentiviral Transduction Particles
nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, zeta
Mouse
18 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000360678    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030612.3-990s21c1
Sequence:CCGGGTGCAACCCAGTTTCACTAAACTCGAGTTTAGTGAAACTGGGTTGCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360605    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030612.3-2400s21c1
Sequence:CCGGGAATGAACAGCCCGTGCATTTCTCGAGAAATGCACGGGCTGTTCATTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030612.3-721s21c1
Sequence:CCGGCAGCCCGTGGATGAGTTTAAGCTCGAGCTTAAACTCATCCACGGGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030612.1-1962s1c1
Sequence:CCGGGCTCTTCACATGCTGGACATTCTCGAGAATGTCCAGCATGTGAAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081758    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030612.1-2766s1c1
Sequence:CCGGCCCTGATGTATCTGTAACATACTCGAGTATGTTACAGATACATCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030612.1-1167s1c1
Sequence:CCGGGCCCTGCTTCAGAATATTATACTCGAGTATAATATTCTGAAGCAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030612.1-1367s1c1
Sequence:CCGGCCAGGCGTCAATGTACCAGTACTCGAGTACTGGTACATTGACGCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030612.1-2424s1c1
Sequence:CCGGGAAGCAAATCTGGAACTCATTCTCGAGAATGAGTTCCAGATTTGCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244369    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030612.2-1368s21c1
Sequence:CCGGAGGCGTCAATGTACCAGTATTCTCGAGAATACTGGTACATTGACGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244368    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030612.2-2833s21c1
Sequence:CCGGACCCATTTAGTTCACTATTATCTCGAGATAATAGTGAACTAAATGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244367    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030612.2-2187s21c1
Sequence:CCGGATCTTGAGGCAACGAACTATGCTCGAGCATAGTTCGTTGCCTCAAGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244366    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030612.2-1764s21c1
Sequence:CCGGTCATGGGAAGCCCGATGAATACTCGAGTATTCATCGGGCTTCCCATGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244365    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030612.2-2323s21c1
Sequence:CCGGGAGCCTGGTAGACACCATTAACTCGAGTTAATGGTGTCTACCAGGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360609    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030612.3-2710s21c1
Sequence:CCGGCCAGGTATCTGGGATCTATATCTCGAGATATAGATCCCAGATACCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030612.3-1290s21c1
Sequence:CCGGCCAGTCTCCCAAGTATGATTCCTCGAGGAATCATACTTGGGAGACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360606    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030612.3-1828s21c1
Sequence:CCGGATTGTGCAAGATCTGGTAAACCTCGAGGTTTACCAGATCTTGCACAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360677    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030612.3-1952s21c1
Sequence:CCGGCTGTGAGGAGCAATCAGTTTGCTCGAGCAAACTGATTGCTCCTCACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360672    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030612.3-2684s21c1
Sequence:CCGGTCTTGGCAGATTTGCGTATTTCTCGAGAAATACGCAAATCTGCCAAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031419
VALIDATED
NFKBIZ MISSION shRNA Bacterial Glycerol Stock
nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, zeta
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000149301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031419.1-736s1c1
Sequence:CCGGGTTTCCCTGAACACAGTTCAACTCGAGTTGAACTGTGTTCAGGGAAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000131219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031419.1-135s1c1
Sequence:CCGGGCTCAACCTGAGCTACTTCTACTCGAGTAGAAGTAGCTCAGGTTGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031419.1-1438s1c1
Sequence:CCGGGCAAGAAAGATGAATGCACTTCTCGAGAAGTGCATTCATCTTTCTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128305    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031419.1-1009s1c1
Sequence:CCGGGCTTATGAACCAAACCTCTTTCTCGAGAAAGAGGTTTGGTTCATAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369624    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031419.2-757s21c1
Sequence:CCGGTGATCTGCTTCAGAACATTATCTCGAGATAATGTTCTGAAGCAGATCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369625    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_031419.2-2251s21c1
Sequence:CCGGGCAGAGAGCTCCACCGTATTACTCGAGTAATACGGTGGAGCTCTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364803    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 2 Clone ID:NM_031419.2-1882s21c1
Sequence:CCGGGAGTCTGGTTGATACCATTAACTCGAGTTAATGGTATCAACCAGACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031419.1-431s1c1
Sequence:CCGGGAAGTCATAAACAGAAGGCTTCTCGAGAAGCCTTCTGTTTATGACTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147551    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_031419.1-1915s1c1
Sequence:CCGGGAAGCAAATCTGGAACTCATTCTCGAGAATGAGTTCCAGATTTGCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031419.1-1464s1c1
Sequence:CCGGGCTGGATATTAAAGAGCACAACTCGAGTTGTGCTCTTTAATATCCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031419.1-1267s1c1
Sequence:CCGGCCAATGAACACCACACAGTTACTCGAGTAACTGTGTGGTGTTCATTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031419.1-2026s1c1
Sequence:CCGGCAGTATCGGTTGACACAATTACTCGAGTAATTGTGTCAACCGATACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364866    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031419.2-1521s21c1
Sequence:CCGGCACTTCACATGCTGGATATTACTCGAGTAATATCCAGCATGTGAAGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369626    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031419.2-2329s21c1
Sequence:CCGGGTATCTGTACATAGACCATTTCTCGAGAAATGGTCTATGTACAGATACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031419
VALIDATED
NFKBIZ MISSION shRNA shRNA Plasmid DNA
nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, zeta
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000149301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031419.1-736s1c1
Sequence:CCGGGTTTCCCTGAACACAGTTCAACTCGAGTTGAACTGTGTTCAGGGAAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000131219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031419.1-135s1c1
Sequence:CCGGGCTCAACCTGAGCTACTTCTACTCGAGTAGAAGTAGCTCAGGTTGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031419.1-1438s1c1
Sequence:CCGGGCAAGAAAGATGAATGCACTTCTCGAGAAGTGCATTCATCTTTCTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128305    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031419.1-1009s1c1
Sequence:CCGGGCTTATGAACCAAACCTCTTTCTCGAGAAAGAGGTTTGGTTCATAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000369624    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031419.2-757s21c1
Sequence:CCGGTGATCTGCTTCAGAACATTATCTCGAGATAATGTTCTGAAGCAGATCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000369625    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_031419.2-2251s21c1
Sequence:CCGGGCAGAGAGCTCCACCGTATTACTCGAGTAATACGGTGGAGCTCTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000364803    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 2 Clone ID:NM_031419.2-1882s21c1
Sequence:CCGGGAGTCTGGTTGATACCATTAACTCGAGTTAATGGTATCAACCAGACTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031419.1-431s1c1
Sequence:CCGGGAAGTCATAAACAGAAGGCTTCTCGAGAAGCCTTCTGTTTATGACTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147551    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_031419.1-1915s1c1
Sequence:CCGGGAAGCAAATCTGGAACTCATTCTCGAGAATGAGTTCCAGATTTGCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031419.1-1464s1c1
Sequence:CCGGGCTGGATATTAAAGAGCACAACTCGAGTTGTGCTCTTTAATATCCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031419.1-1267s1c1
Sequence:CCGGCCAATGAACACCACACAGTTACTCGAGTAACTGTGTGGTGTTCATTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031419.1-2026s1c1
Sequence:CCGGCAGTATCGGTTGACACAATTACTCGAGTAATTGTGTCAACCGATACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000364866    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031419.2-1521s21c1
Sequence:CCGGCACTTCACATGCTGGATATTACTCGAGTAATATCCAGCATGTGAAGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000369626    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031419.2-2329s21c1
Sequence:CCGGGTATCTGTACATAGACCATTTCTCGAGAAATGGTCTATGTACAGATACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031419
VALIDATED
NFKBIZ MISSION shRNA Lentiviral Transduction Particles
nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, zeta
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000149301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031419.1-736s1c1
Sequence:CCGGGTTTCCCTGAACACAGTTCAACTCGAGTTGAACTGTGTTCAGGGAAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000131219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031419.1-135s1c1
Sequence:CCGGGCTCAACCTGAGCTACTTCTACTCGAGTAGAAGTAGCTCAGGTTGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031419.1-1438s1c1
Sequence:CCGGGCAAGAAAGATGAATGCACTTCTCGAGAAGTGCATTCATCTTTCTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128305    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031419.1-1009s1c1
Sequence:CCGGGCTTATGAACCAAACCTCTTTCTCGAGAAAGAGGTTTGGTTCATAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369624    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031419.2-757s21c1
Sequence:CCGGTGATCTGCTTCAGAACATTATCTCGAGATAATGTTCTGAAGCAGATCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369625    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_031419.2-2251s21c1
Sequence:CCGGGCAGAGAGCTCCACCGTATTACTCGAGTAATACGGTGGAGCTCTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364803    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 2 Clone ID:NM_031419.2-1882s21c1
Sequence:CCGGGAGTCTGGTTGATACCATTAACTCGAGTTAATGGTATCAACCAGACTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031419.1-431s1c1
Sequence:CCGGGAAGTCATAAACAGAAGGCTTCTCGAGAAGCCTTCTGTTTATGACTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147551    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_031419.1-1915s1c1
Sequence:CCGGGAAGCAAATCTGGAACTCATTCTCGAGAATGAGTTCCAGATTTGCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031419.1-1464s1c1
Sequence:CCGGGCTGGATATTAAAGAGCACAACTCGAGTTGTGCTCTTTAATATCCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031419.1-1267s1c1
Sequence:CCGGCCAATGAACACCACACAGTTACTCGAGTAACTGTGTGGTGTTCATTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031419.1-2026s1c1
Sequence:CCGGCAGTATCGGTTGACACAATTACTCGAGTAATTGTGTCAACCGATACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364866    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031419.2-1521s21c1
Sequence:CCGGCACTTCACATGCTGGATATTACTCGAGTAATATCCAGCATGTGAAGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369626    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031419.2-2329s21c1
Sequence:CCGGGTATCTGTACATAGACCATTTCTCGAGAAATGGTCTATGTACAGATACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)