EMAIL THIS PAGE TO A FRIEND

NFRKB

nuclear factor related to kappaB binding protein

54 Gene Product Result for
Synonyms: INO80G
UniProtKB ID: Q6P4R8, Q12869, Q15312, Q9H048
Gene ID:
Mouse(235134) nuclear factor related to kappa B binding protein
Rat(315523) nuclear factor related to kappa B binding protein
chicken(419730) nuclear factor related to kappaB binding protein
cow(510304) nuclear factor related to kappaB binding protein
domestic cat(101092460) nuclear factor related to kappaB binding protein
Horse(100146937) nuclear factor related to kappaB binding protein
dog(489280) nuclear factor related to kappaB binding protein
sheep(101118827) nuclear factor related to kappaB binding protein
domestic guinea pig(100730750) nuclear factor related to kappaB binding protein
Domestic Rabbit(100340975) nuclear factor related to kappaB binding protein
naked mole-rat(101724980) nuclear factor related to kappaB binding protein
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006165 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006165 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006165 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172766 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172766 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172766 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU065191 MISSION® esiRNA esiRNA human NFRKB (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006165 Rosetta Predictions human pricing
NM_001108133 Rosetta Predictions rat pricing
NM_172766 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006165 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00341019 predicted 3886
2 SASI_Hs02_00341020 predicted 474
3 SASI_Hs01_00042593 predicted 2051
4 SASI_Hs01_00042594 predicted 606
5 SASI_Hs02_00341021 predicted 2320
6 SASI_Hs01_00042595 predicted 266
7 SASI_Hs01_00042596 predicted 2509
8 SASI_Hs01_00042597 predicted 2126
9 SASI_Hs02_00341022 predicted 2007
10 SASI_Hs02_00341023 predicted 1675
11 SASI_Hs01_00042592 predicted 3159
12 SASI_Hs01_00042598 predicted 2291
13 SASI_Hs01_00042599 predicted 3035
14 SASI_Hs01_00042600 predicted 3587
15 SASI_Hs01_00042601 predicted 2457
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108133 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00235684 predicted 3427
2 SASI_Rn02_00235685 predicted 3619
3 SASI_Rn02_00235686 predicted 1505
4 SASI_Rn02_00235687 predicted 3271
5 SASI_Rn02_00235688 predicted 2384
6 SASI_Rn02_00235689 predicted 2743
7 SASI_Rn02_00235690 predicted 1745
8 SASI_Rn02_00235691 predicted 3807
9 SASI_Rn02_00235692 predicted 3469
10 SASI_Rn02_00235693 predicted 328
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172766 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00047033 predicted 3405
2 SASI_Mm02_00344643 predicted 3784
3 SASI_Mm01_00047034 predicted 3592
4 SASI_Mm01_00047035 predicted 3848
5 SASI_Mm01_00047036 predicted 1473
6 SASI_Mm01_00047037 predicted 491
7 SASI_Mm01_00047038 predicted 1712
8 SASI_Mm01_00047039 predicted 3233
9 SASI_Mm01_00047040 predicted 3792
10 SASI_Mm01_00047041 predicted 2358
11 SASI_Mm01_00047042 predicted 3046
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006165
VALIDATED
NFRKB MISSION shRNA Bacterial Glycerol Stock
nuclear factor related to kappaB binding protein
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000014868    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_006165.2-4167s1c1
Sequence:CCGGCAGGGAGGTTGCATCATTGTTCTCGAGAACAATGATGCAACCTCCCTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006165.2-809s1c1
Sequence:CCGGGCCACGTTGGATTTACAAGAACTCGAGTTCTTGTAAATCCAACGTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006165.2-3153s1c1
Sequence:CCGGCCCAGGTTACCACAGTCAAATCTCGAGATTTGACTGTGGTAACCTGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014869    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006165.2-915s1c1
Sequence:CCGGCCACACTTTCAACCACGGATACTCGAGTATCCGTGGTTGAAAGTGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014870    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_006165.2-2111s1c1
Sequence:CCGGCCCTGTGTGAAATACGACATTCTCGAGAATGTCGTATTTCACACAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232103    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006165.2-499s21c1
Sequence:CCGGTTTCCGAGACGGACACTTTAACTCGAGTTAAAGTGTCCGTCTCGGAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232106    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_006165.2-2046s21c1
Sequence:CCGGTCACCAGCACTCAGGTAAATACTCGAGTATTTACCTGAGTGCTGGTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232107    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006165.2-4113s21c1
Sequence:CCGGAGAGGATGGCTTCCGTGAAAGCTCGAGCTTTCACGGAAGCCATCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232105    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006165.2-916s21c1
Sequence:CCGGCACACTTTCAACCACGGATATCTCGAGATATCCGTGGTTGAAAGTGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232104    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006165.2-738s21c1
Sequence:CCGGAGCGCTACTTGAAGGTCTTAACTCGAGTTAAGACCTTCAAGTAGCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006165
VALIDATED
NFRKB MISSION shRNA shRNA Plasmid DNA
nuclear factor related to kappaB binding protein
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000014868    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_006165.2-4167s1c1
Sequence:CCGGCAGGGAGGTTGCATCATTGTTCTCGAGAACAATGATGCAACCTCCCTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006165.2-809s1c1
Sequence:CCGGGCCACGTTGGATTTACAAGAACTCGAGTTCTTGTAAATCCAACGTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006165.2-3153s1c1
Sequence:CCGGCCCAGGTTACCACAGTCAAATCTCGAGATTTGACTGTGGTAACCTGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014869    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006165.2-915s1c1
Sequence:CCGGCCACACTTTCAACCACGGATACTCGAGTATCCGTGGTTGAAAGTGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014870    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_006165.2-2111s1c1
Sequence:CCGGCCCTGTGTGAAATACGACATTCTCGAGAATGTCGTATTTCACACAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232103    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006165.2-499s21c1
Sequence:CCGGTTTCCGAGACGGACACTTTAACTCGAGTTAAAGTGTCCGTCTCGGAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232106    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_006165.2-2046s21c1
Sequence:CCGGTCACCAGCACTCAGGTAAATACTCGAGTATTTACCTGAGTGCTGGTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232107    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006165.2-4113s21c1
Sequence:CCGGAGAGGATGGCTTCCGTGAAAGCTCGAGCTTTCACGGAAGCCATCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232105    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006165.2-916s21c1
Sequence:CCGGCACACTTTCAACCACGGATATCTCGAGATATCCGTGGTTGAAAGTGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232104    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006165.2-738s21c1
Sequence:CCGGAGCGCTACTTGAAGGTCTTAACTCGAGTTAAGACCTTCAAGTAGCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006165
VALIDATED
NFRKB MISSION shRNA Lentiviral Transduction Particles
nuclear factor related to kappaB binding protein
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000014868    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_006165.2-4167s1c1
Sequence:CCGGCAGGGAGGTTGCATCATTGTTCTCGAGAACAATGATGCAACCTCCCTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006165.2-809s1c1
Sequence:CCGGGCCACGTTGGATTTACAAGAACTCGAGTTCTTGTAAATCCAACGTGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006165.2-3153s1c1
Sequence:CCGGCCCAGGTTACCACAGTCAAATCTCGAGATTTGACTGTGGTAACCTGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014869    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006165.2-915s1c1
Sequence:CCGGCCACACTTTCAACCACGGATACTCGAGTATCCGTGGTTGAAAGTGTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014870    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_006165.2-2111s1c1
Sequence:CCGGCCCTGTGTGAAATACGACATTCTCGAGAATGTCGTATTTCACACAGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232103    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006165.2-499s21c1
Sequence:CCGGTTTCCGAGACGGACACTTTAACTCGAGTTAAAGTGTCCGTCTCGGAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232106    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_006165.2-2046s21c1
Sequence:CCGGTCACCAGCACTCAGGTAAATACTCGAGTATTTACCTGAGTGCTGGTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232107    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006165.2-4113s21c1
Sequence:CCGGAGAGGATGGCTTCCGTGAAAGCTCGAGCTTTCACGGAAGCCATCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232105    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006165.2-916s21c1
Sequence:CCGGCACACTTTCAACCACGGATATCTCGAGATATCCGTGGTTGAAAGTGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232104    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006165.2-738s21c1
Sequence:CCGGAGCGCTACTTGAAGGTCTTAACTCGAGTTAAGACCTTCAAGTAGCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172766
VALIDATED
NFRKB MISSION shRNA Bacterial Glycerol Stock
nuclear factor related to kappaB binding protein
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000085158    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172766.2-4334s1c1
Sequence:CCGGGCCTCATTCTATGTGAGGTTTCTCGAGAAACCTCACATAGAATGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085162    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172766.2-2009s1c1
Sequence:CCGGCCCTTGTGTGAAATATGACATCTCGAGATGTCATATTTCACACAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085159    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172766.2-1008s1c1
Sequence:CCGGGCCTTGTATGATTTGGCTGTTCTCGAGAACAGCCAAATCATACAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085160    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172766.2-3481s1c1
Sequence:CCGGCGGTGTCCTTACCCAGTATAACTCGAGTTATACTGGGTAAGGACACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085161    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172766.2-674s1c1
Sequence:CCGGGCAGCGTTACTTGAAAGTCTTCTCGAGAAGACTTTCAAGTAACGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172766
VALIDATED
NFRKB MISSION shRNA shRNA Plasmid DNA
nuclear factor related to kappaB binding protein
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000085158    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172766.2-4334s1c1
Sequence:CCGGGCCTCATTCTATGTGAGGTTTCTCGAGAAACCTCACATAGAATGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085162    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172766.2-2009s1c1
Sequence:CCGGCCCTTGTGTGAAATATGACATCTCGAGATGTCATATTTCACACAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085159    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172766.2-1008s1c1
Sequence:CCGGGCCTTGTATGATTTGGCTGTTCTCGAGAACAGCCAAATCATACAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085160    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172766.2-3481s1c1
Sequence:CCGGCGGTGTCCTTACCCAGTATAACTCGAGTTATACTGGGTAAGGACACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085161    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172766.2-674s1c1
Sequence:CCGGGCAGCGTTACTTGAAAGTCTTCTCGAGAAGACTTTCAAGTAACGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172766
VALIDATED
NFRKB MISSION shRNA Lentiviral Transduction Particles
nuclear factor related to kappaB binding protein
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000085158    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172766.2-4334s1c1
Sequence:CCGGGCCTCATTCTATGTGAGGTTTCTCGAGAAACCTCACATAGAATGAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085162    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172766.2-2009s1c1
Sequence:CCGGCCCTTGTGTGAAATATGACATCTCGAGATGTCATATTTCACACAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085159    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172766.2-1008s1c1
Sequence:CCGGGCCTTGTATGATTTGGCTGTTCTCGAGAACAGCCAAATCATACAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085160    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172766.2-3481s1c1
Sequence:CCGGCGGTGTCCTTACCCAGTATAACTCGAGTTATACTGGGTAAGGACACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085161    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172766.2-674s1c1
Sequence:CCGGGCAGCGTTACTTGAAAGTCTTCTCGAGAAGACTTTCAAGTAACGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)