EMAIL THIS PAGE TO A FRIEND

NFU1

NFU1 iron-sulfur cluster scaffold homolog (S. cerevisiae)

81 Gene Product Result for
Synonyms: HIRIP HIRIP5 MMDS1 NIFUC Nfu NifU
Gene ID:
Human(27247) Summary: This gene encodes a protein that is localized to mitochondria and plays a critical role in iron-sulfur cluster biogenesis. The encoded protein assembles and transfers 4Fe-4S clusters to target apoproteins including succinate dehydrogenase and lipoic acid synthase. Mutations in this gene are a cause of multiple mitochondrial dysfunctions syndrome-1, and pseudogenes of this gene are located on the short arms of chromosomes 1 and 3. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2011]
Mouse(56748) NFU1 iron-sulfur cluster scaffold homolog (S. cerevisiae)
Rat(297416) NFU1 iron-sulfur cluster scaffold homolog (S. cerevisiae)
Thale Cress(828196) NifU-like protein 1
cow(615964) NFU1 iron-sulfur cluster scaffold homolog (S. cerevisiae)
domestic cat(101093596) NFU1 iron-sulfur cluster scaffold homolog (S. cerevisiae)
dog(612607) NFU1 iron-sulfur cluster scaffold homolog (S. cerevisiae)
chicken(419513) NFU1 iron-sulfur cluster scaffold homolog (S. cerevisiae)
Zebrafish(403053) NFU1 iron-sulfur cluster scaffold homolog (S. cerevisiae)
sheep(101107942) NFU1 iron-sulfur cluster scaffold homolog (S. cerevisiae)
domestic guinea pig(100727939) NFU1 iron-sulfur cluster scaffold homolog (S. cerevisiae)
naked mole-rat(101700550) NFU1 iron-sulfur cluster scaffold homolog (S. cerevisiae)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001002755 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001002755 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001002755 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_015700 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015700 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015700 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_020045 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_020045 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_020045 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU002991 MISSION® esiRNA esiRNA targeting human NFU1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001002755 Rosetta Predictions human pricing
NM_001002756 Rosetta Predictions human pricing
NM_001002757 Rosetta Predictions human pricing
NM_015700 Rosetta Predictions human pricing
NM_001106606 Rosetta Predictions rat pricing
NM_020045 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001002755 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00059974 predicted 703
2 SASI_Hs01_00059975 predicted 833
3 SASI_Hs01_00059976 predicted 765
4 SASI_Hs01_00059977 predicted 834
5 SASI_Hs01_00059978 predicted 806
6 SASI_Hs01_00059979 predicted 705
7 SASI_Hs01_00059980 predicted 719
8 SASI_Hs01_00059981 predicted 711
9 SASI_Hs02_00304190 predicted 839
10 SASI_Hs01_00059983 predicted 738
11 SASI_Hs01_00059982 predicted 864
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001002756 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00105077 predicted 653
2 SASI_Hs01_00105078 predicted 784
3 SASI_Hs01_00105079 predicted 715
4 SASI_Hs01_00105080 predicted 783
5 SASI_Hs01_00105081 predicted 757
6 SASI_Hs01_00105082 predicted 658
7 SASI_Hs01_00105083 predicted 672
8 SASI_Hs01_00105084 predicted 661
9 SASI_Hs02_00304191 predicted 791
10 SASI_Hs01_00105086 predicted 696
11 SASI_Hs01_00105085 predicted 820
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001002757 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00124786 predicted 561
2 SASI_Hs01_00124787 predicted 703
3 SASI_Hs01_00124788 predicted 626
4 SASI_Hs01_00124789 predicted 692
5 SASI_Hs01_00124790 predicted 668
6 SASI_Hs01_00124791 predicted 571
7 SASI_Hs01_00124792 predicted 579
8 SASI_Hs01_00124793 predicted 571
9 SASI_Hs02_00304192 predicted 699
10 SASI_Hs01_00124795 predicted 599
11 SASI_Hs01_00124794 predicted 732
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015700 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00212521 predicted 787
2 SASI_Hs01_00212522 predicted 924
3 SASI_Hs01_00212523 predicted 855
4 SASI_Hs01_00212524 predicted 924
5 SASI_Hs01_00212525 predicted 892
6 SASI_Hs01_00212526 predicted 792
7 SASI_Hs01_00212527 predicted 811
8 SASI_Hs01_00212528 predicted 794
9 SASI_Hs02_00348364 predicted 927
10 SASI_Hs01_00212530 predicted 828
11 SASI_Hs01_00212529 predicted 960
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106606 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00220608 predicted 598
2 SASI_Rn02_00220609 predicted 606
3 SASI_Rn02_00220610 predicted 889
4 SASI_Rn02_00220611 predicted 633
5 SASI_Rn02_00220612 predicted 414
6 SASI_Rn02_00220613 predicted 501
7 SASI_Rn02_00220614 predicted 667
8 SASI_Rn02_00220615 predicted 560
9 SASI_Rn02_00220616 predicted 636
10 SASI_Rn02_00220617 predicted 789
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020045 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00110817 predicted 490
2 SASI_Mm02_00325411 predicted 191
3 SASI_Mm01_00110819 predicted 389
4 SASI_Mm01_00110820 predicted 284
5 SASI_Mm01_00110821 predicted 385
6 SASI_Mm01_00110822 predicted 379
7 SASI_Mm01_00110823 predicted 209
8 SASI_Mm01_00110824 predicted 362
9 SASI_Mm01_00110825 predicted 539
10 SASI_Mm01_00110826 predicted 521
11 SASI_Mm01_00110818 predicted 415
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001002755
NFU1 MISSION shRNA Bacterial Glycerol Stock
NFU1 iron-sulfur cluster scaffold homolog (S. cerevisiae)
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000352861    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001002755.1-680s21c1
Sequence:CCGGGCAGGATCTGAAGAAGATGATCTCGAGATCATCTTCTTCAGATCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343466    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001002755.1-659s21c1
Sequence:CCGGGAGGAAACACCTTCAGGAGAACTCGAGTTCTCCTGAAGGTGTTTCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343421    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001002755.1-731s21c1
Sequence:CCGGGATACTAGAATACGGCCAACTCTCGAGAGTTGGCCGTATTCTAGTATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343468    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001002755.1-770s21c1
Sequence:CCGGGATGTAATCTACAAAGGCTTTCTCGAGAAAGCCTTTGTAGATTACATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352929    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001002755.1-914s21c1
Sequence:CCGGGAACAGGTTATGGATGATGAACTCGAGTTCATCATCCATAACCTGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001002755
NFU1 MISSION shRNA shRNA Plasmid DNA
NFU1 iron-sulfur cluster scaffold homolog (S. cerevisiae)
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000352861    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001002755.1-680s21c1
Sequence:CCGGGCAGGATCTGAAGAAGATGATCTCGAGATCATCTTCTTCAGATCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343466    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001002755.1-659s21c1
Sequence:CCGGGAGGAAACACCTTCAGGAGAACTCGAGTTCTCCTGAAGGTGTTTCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343421    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001002755.1-731s21c1
Sequence:CCGGGATACTAGAATACGGCCAACTCTCGAGAGTTGGCCGTATTCTAGTATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343468    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001002755.1-770s21c1
Sequence:CCGGGATGTAATCTACAAAGGCTTTCTCGAGAAAGCCTTTGTAGATTACATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000352929    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001002755.1-914s21c1
Sequence:CCGGGAACAGGTTATGGATGATGAACTCGAGTTCATCATCCATAACCTGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001002755
NFU1 MISSION shRNA Lentiviral Transduction Particles
NFU1 iron-sulfur cluster scaffold homolog (S. cerevisiae)
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000352861    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001002755.1-680s21c1
Sequence:CCGGGCAGGATCTGAAGAAGATGATCTCGAGATCATCTTCTTCAGATCCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343466    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001002755.1-659s21c1
Sequence:CCGGGAGGAAACACCTTCAGGAGAACTCGAGTTCTCCTGAAGGTGTTTCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343421    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001002755.1-731s21c1
Sequence:CCGGGATACTAGAATACGGCCAACTCTCGAGAGTTGGCCGTATTCTAGTATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343468    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001002755.1-770s21c1
Sequence:CCGGGATGTAATCTACAAAGGCTTTCTCGAGAAAGCCTTTGTAGATTACATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352929    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001002755.1-914s21c1
Sequence:CCGGGAACAGGTTATGGATGATGAACTCGAGTTCATCATCCATAACCTGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015700
VALIDATED
NFU1 MISSION shRNA Bacterial Glycerol Stock
NFU1 iron-sulfur cluster scaffold homolog (S. cerevisiae)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000142820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015700.1-430s1c1
Sequence:CCGGCCAGATTTCATCACTGTCACACTCGAGTGTGACAGTGATGAAATCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143239    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_015700.1-616s1c1
Sequence:CCGGGATACTAGAATACGGCCAACTCTCGAGAGTTGGCCGTATTCTAGTATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143337    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_015700.1-565s1c1
Sequence:CCGGGCAGGATCTGAAGAAGATGATCTCGAGATCATCTTCTTCAGATCCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140166    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_015700.1-544s1c1
Sequence:CCGGGAGGAAACACCTTCAGGAGAACTCGAGTTCTCCTGAAGGTGTTTCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139264    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015700.1-325s1c1
Sequence:CCGGCTTGAGACAAGGACCATGGATCTCGAGATCCATGGTCCTTGTCTCAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121681    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_015700.1-799s1c1
Sequence:CCGGGAACAGGTTATGGATGATGAACTCGAGTTCATCATCCATAACCTGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015700.1-296s1c1
Sequence:CCGGGCTTAAAGTTTATACCAGGAACTCGAGTTCCTGGTATAAACTTTAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122333    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_015700.1-376s1c1
Sequence:CCGGCCTCTGGCTAGGCAGTTATTTCTCGAGAAATAACTGCCTAGCCAGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122171    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_015700.1-655s1c1
Sequence:CCGGGATGTAATCTACAAAGGCTTTCTCGAGAAAGCCTTTGTAGATTACATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015700
VALIDATED
NFU1 MISSION shRNA shRNA Plasmid DNA
NFU1 iron-sulfur cluster scaffold homolog (S. cerevisiae)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000142820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015700.1-430s1c1
Sequence:CCGGCCAGATTTCATCACTGTCACACTCGAGTGTGACAGTGATGAAATCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143239    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_015700.1-616s1c1
Sequence:CCGGGATACTAGAATACGGCCAACTCTCGAGAGTTGGCCGTATTCTAGTATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143337    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_015700.1-565s1c1
Sequence:CCGGGCAGGATCTGAAGAAGATGATCTCGAGATCATCTTCTTCAGATCCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140166    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_015700.1-544s1c1
Sequence:CCGGGAGGAAACACCTTCAGGAGAACTCGAGTTCTCCTGAAGGTGTTTCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139264    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015700.1-325s1c1
Sequence:CCGGCTTGAGACAAGGACCATGGATCTCGAGATCCATGGTCCTTGTCTCAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121681    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_015700.1-799s1c1
Sequence:CCGGGAACAGGTTATGGATGATGAACTCGAGTTCATCATCCATAACCTGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015700.1-296s1c1
Sequence:CCGGGCTTAAAGTTTATACCAGGAACTCGAGTTCCTGGTATAAACTTTAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122333    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_015700.1-376s1c1
Sequence:CCGGCCTCTGGCTAGGCAGTTATTTCTCGAGAAATAACTGCCTAGCCAGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122171    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_015700.1-655s1c1
Sequence:CCGGGATGTAATCTACAAAGGCTTTCTCGAGAAAGCCTTTGTAGATTACATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015700
VALIDATED
NFU1 MISSION shRNA Lentiviral Transduction Particles
NFU1 iron-sulfur cluster scaffold homolog (S. cerevisiae)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000142820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015700.1-430s1c1
Sequence:CCGGCCAGATTTCATCACTGTCACACTCGAGTGTGACAGTGATGAAATCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143239    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_015700.1-616s1c1
Sequence:CCGGGATACTAGAATACGGCCAACTCTCGAGAGTTGGCCGTATTCTAGTATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143337    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_015700.1-565s1c1
Sequence:CCGGGCAGGATCTGAAGAAGATGATCTCGAGATCATCTTCTTCAGATCCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140166    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_015700.1-544s1c1
Sequence:CCGGGAGGAAACACCTTCAGGAGAACTCGAGTTCTCCTGAAGGTGTTTCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139264    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015700.1-325s1c1
Sequence:CCGGCTTGAGACAAGGACCATGGATCTCGAGATCCATGGTCCTTGTCTCAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121681    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_015700.1-799s1c1
Sequence:CCGGGAACAGGTTATGGATGATGAACTCGAGTTCATCATCCATAACCTGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015700.1-296s1c1
Sequence:CCGGGCTTAAAGTTTATACCAGGAACTCGAGTTCCTGGTATAAACTTTAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122333    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_015700.1-376s1c1
Sequence:CCGGCCTCTGGCTAGGCAGTTATTTCTCGAGAAATAACTGCCTAGCCAGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122171    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_015700.1-655s1c1
Sequence:CCGGGATGTAATCTACAAAGGCTTTCTCGAGAAAGCCTTTGTAGATTACATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020045
VALIDATED
NFU1 MISSION shRNA Bacterial Glycerol Stock
NFU1 iron-sulfur cluster scaffold homolog (S. cerevisiae)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000174837    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020045.1-507s1c1
Sequence:CCGGGCAATGATTAAAGAACTGCTACTCGAGTAGCAGTTCTTTAATCATTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175041    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020045.1-501s1c1
Sequence:CCGGGTCGTGGCAATGATTAAAGAACTCGAGTTCTTTAATCATTGCCACGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193513    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020045.1-296s1c1
Sequence:CCGGGTTATTCAGAATTGAAGGTGTCTCGAGACACCTTCAATTCTGAATAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193555    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020045.1-366s1c1
Sequence:CCGGGAAGAGTTAGACTGGAATTTACTCGAGTAAATTCCAGTCTAACTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292602    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020045.2-367s21c1
Sequence:CCGGGAAGAGTTAGACTGGAATTTACTCGAGTAAATTCCAGTCTAACTCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292649    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020045.2-502s21c1
Sequence:CCGGGTCGTGGCAATGATTAAAGAACTCGAGTTCTTTAATCATTGCCACGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292648    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020045.2-297s21c1
Sequence:CCGGGTTATTCAGAATTGAAGGTGTCTCGAGACACCTTCAATTCTGAATAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292722    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020045.2-666s21c1
Sequence:CCGGGATTCAGAACATGCTGCAGTTCTCGAGAACTGCAGCATGTTCTGAATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176087    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020045.1-665s1c1
Sequence:CCGGGATTCAGAACATGCTGCAGTTCTCGAGAACTGCAGCATGTTCTGAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020045
VALIDATED
NFU1 MISSION shRNA shRNA Plasmid DNA
NFU1 iron-sulfur cluster scaffold homolog (S. cerevisiae)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000174837    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020045.1-507s1c1
Sequence:CCGGGCAATGATTAAAGAACTGCTACTCGAGTAGCAGTTCTTTAATCATTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175041    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020045.1-501s1c1
Sequence:CCGGGTCGTGGCAATGATTAAAGAACTCGAGTTCTTTAATCATTGCCACGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193513    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020045.1-296s1c1
Sequence:CCGGGTTATTCAGAATTGAAGGTGTCTCGAGACACCTTCAATTCTGAATAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193555    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020045.1-366s1c1
Sequence:CCGGGAAGAGTTAGACTGGAATTTACTCGAGTAAATTCCAGTCTAACTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000292602    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020045.2-367s21c1
Sequence:CCGGGAAGAGTTAGACTGGAATTTACTCGAGTAAATTCCAGTCTAACTCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000292649    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020045.2-502s21c1
Sequence:CCGGGTCGTGGCAATGATTAAAGAACTCGAGTTCTTTAATCATTGCCACGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000292648    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020045.2-297s21c1
Sequence:CCGGGTTATTCAGAATTGAAGGTGTCTCGAGACACCTTCAATTCTGAATAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000292722    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020045.2-666s21c1
Sequence:CCGGGATTCAGAACATGCTGCAGTTCTCGAGAACTGCAGCATGTTCTGAATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176087    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020045.1-665s1c1
Sequence:CCGGGATTCAGAACATGCTGCAGTTCTCGAGAACTGCAGCATGTTCTGAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020045
VALIDATED
NFU1 MISSION shRNA Lentiviral Transduction Particles
NFU1 iron-sulfur cluster scaffold homolog (S. cerevisiae)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000174837    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020045.1-507s1c1
Sequence:CCGGGCAATGATTAAAGAACTGCTACTCGAGTAGCAGTTCTTTAATCATTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175041    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020045.1-501s1c1
Sequence:CCGGGTCGTGGCAATGATTAAAGAACTCGAGTTCTTTAATCATTGCCACGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193513    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020045.1-296s1c1
Sequence:CCGGGTTATTCAGAATTGAAGGTGTCTCGAGACACCTTCAATTCTGAATAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193555    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020045.1-366s1c1
Sequence:CCGGGAAGAGTTAGACTGGAATTTACTCGAGTAAATTCCAGTCTAACTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292602    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020045.2-367s21c1
Sequence:CCGGGAAGAGTTAGACTGGAATTTACTCGAGTAAATTCCAGTCTAACTCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292649    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020045.2-502s21c1
Sequence:CCGGGTCGTGGCAATGATTAAAGAACTCGAGTTCTTTAATCATTGCCACGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292648    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020045.2-297s21c1
Sequence:CCGGGTTATTCAGAATTGAAGGTGTCTCGAGACACCTTCAATTCTGAATAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292722    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020045.2-666s21c1
Sequence:CCGGGATTCAGAACATGCTGCAGTTCTCGAGAACTGCAGCATGTTCTGAATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176087    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020045.1-665s1c1
Sequence:CCGGGATTCAGAACATGCTGCAGTTCTCGAGAACTGCAGCATGTTCTGAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)