EMAIL THIS PAGE TO A FRIEND

NFX1

nuclear transcription factor, X-box binding 1

219 Gene Product Result for
Synonyms: NFX2
UniProtKB ID: Q12986, A8K6H8, Q5VXW6, Q96EL5, Q9BXI1
Gene ID:
Human(4799) Summary: MHC class II gene expression is controlled primarily at the transcriptional level by transcription factors that bind to the X and Y boxes, two highly conserved elements in the proximal promoter of MHC class II genes. The protein encoded by this gene is a transcriptional repressor capable of binding to the conserved X box motif of HLA-DRA and other MHC class II genes in vitro. The protein may play a role in regulating the duration of an inflammatory response by limiting the period in which class II MHC molecules are induced by IFN-gamma. Three alternative splice variants, each of which encodes a different isoform, have been identified. [provided by RefSeq, Jul 2008]
Mouse(74164) nuclear transcription factor, X-box binding 1
Rat(313166) nuclear transcription factor, X-box binding 1
chicken(420796) nuclear transcription factor, X-box binding 1
dog(481581) nuclear transcription factor, X-box binding 1
domestic cat(101089904) nuclear transcription factor, X-box binding 1
cow(515680) nuclear transcription factor, X-box binding 1
Horse(100053795) nuclear transcription factor, X-box binding 1
naked mole-rat(101724132) nuclear transcription factor, X-box binding 1
domestic guinea pig(100723545) nuclear transcription factor, X-box binding 1
sheep(101103948) nuclear transcription factor, X-box binding 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_023739 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023739 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023739 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002504 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002504 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002504 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002504 Rosetta Predictions human pricing
NM_147133 Rosetta Predictions human pricing
NM_147134 Rosetta Predictions human pricing
NM_001024784 Rosetta Predictions rat pricing
XM_001059354 Rosetta Predictions rat pricing
XM_001059410 Rosetta Predictions rat pricing
XM_001059469 Rosetta Predictions rat pricing
XM_001064398 Rosetta Predictions rat pricing
XM_001064460 Rosetta Predictions rat pricing
NM_023739 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002504 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00071783 predicted 2118
2 SASI_Hs01_00071784 predicted 2257
3 SASI_Hs01_00071785 predicted 440
4 SASI_Hs02_00333965 predicted 1687
5 SASI_Hs01_00071788 predicted 1365
6 SASI_Hs02_00333966 predicted 2107
7 SASI_Hs01_00071789 predicted 2234
8 SASI_Hs01_00071790 predicted 2181
9 SASI_Hs01_00071791 predicted 1871
10 SASI_Hs01_00071792 predicted 579
11 SASI_Hs01_00071786 predicted 1192
12 SASI_Hs01_00071787 predicted 476
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_147133 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00166404 predicted 2117
2 SASI_Hs01_00166405 predicted 2264
3 SASI_Hs01_00166406 predicted 442
4 SASI_Hs02_00365480 predicted 1696
5 SASI_Hs01_00166409 predicted 1371
6 SASI_Hs02_00365481 predicted 2110
7 SASI_Hs01_00166410 predicted 2232
8 SASI_Hs01_00166411 predicted 2177
9 SASI_Hs01_00166412 predicted 1863
10 SASI_Hs01_00166413 predicted 585
11 SASI_Hs01_00166407 predicted 1184
12 SASI_Hs01_00166408 predicted 479
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_147134 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00195283 predicted 2119
2 SASI_Hs01_00195284 predicted 2264
3 SASI_Hs01_00195285 predicted 443
4 SASI_Hs02_00365482 predicted 1691
5 SASI_Hs01_00195288 predicted 1371
6 SASI_Hs02_00365483 predicted 2110
7 SASI_Hs01_00195289 predicted 2230
8 SASI_Hs01_00195290 predicted 2176
9 SASI_Hs01_00195291 predicted 1870
10 SASI_Hs01_00195292 predicted 584
11 SASI_Hs01_00195286 predicted 1194
12 SASI_Hs01_00195287 predicted 470
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024784 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00202679 predicted 1349
2 SASI_Rn02_00202680 predicted 3533
3 SASI_Rn02_00202681 predicted 517
4 SASI_Rn02_00202682 predicted 2211
5 SASI_Rn02_00202683 predicted 355
6 SASI_Rn02_00202684 predicted 2768
7 SASI_Rn02_00202685 predicted 2577
8 SASI_Rn02_00202686 predicted 2246
9 SASI_Rn02_00202687 predicted 1482
10 SASI_Rn02_00202688 predicted 2194
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001059354 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00292953 predicted 924
2 SASI_Rn02_00292954 predicted 2169
3 SASI_Rn02_00292955 predicted 1352
4 SASI_Rn02_00292956 predicted 514
5 SASI_Rn02_00292957 predicted 2209
6 SASI_Rn02_00292958 predicted 356
7 SASI_Rn02_00292959 predicted 424
8 SASI_Rn02_00292960 predicted 2244
9 SASI_Rn02_00292961 predicted 1482
10 SASI_Rn02_00292962 predicted 2194
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001059410 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00293106 predicted 931
2 SASI_Rn02_00293107 predicted 1345
3 SASI_Rn02_00293108 predicted 518
4 SASI_Rn02_00293109 predicted 2211
5 SASI_Rn02_00293110 predicted 353
6 SASI_Rn02_00293111 predicted 2759
7 SASI_Rn02_00293112 predicted 2571
8 SASI_Rn02_00293113 predicted 2246
9 SASI_Rn02_00293114 predicted 1484
10 SASI_Rn02_00293115 predicted 2196
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001059469 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00293325 predicted 1345
2 SASI_Rn02_00293326 predicted 3533
3 SASI_Rn02_00293327 predicted 515
4 SASI_Rn02_00293328 predicted 2211
5 SASI_Rn02_00293329 predicted 356
6 SASI_Rn02_00293330 predicted 2767
7 SASI_Rn02_00293331 predicted 2574
8 SASI_Rn02_00293332 predicted 2244
9 SASI_Rn02_00293333 predicted 1483
10 SASI_Rn02_00293334 predicted 2193
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001064398 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00310314 predicted 922
2 SASI_Rn02_00310315 predicted 1346
3 SASI_Rn02_00310316 predicted 521
4 SASI_Rn02_00310317 predicted 349
5 SASI_Rn02_00310318 predicted 751
6 SASI_Rn02_00310319 predicted 421
7 SASI_Rn02_00310320 predicted 1482
8 SASI_Rn02_00310321 predicted 1693
9 SASI_Rn02_00310322 predicted 1363
10 SASI_Rn02_00310323 predicted 518
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001064460 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00310605 predicted 930
2 SASI_Rn02_00310606 predicted 2170
3 SASI_Rn02_00310607 predicted 1349
4 SASI_Rn02_00310608 predicted 520
5 SASI_Rn02_00310609 predicted 2213
6 SASI_Rn02_00310610 predicted 349
7 SASI_Rn02_00310611 predicted 759
8 SASI_Rn02_00310612 predicted 425
9 SASI_Rn02_00310613 predicted 2247
10 SASI_Rn02_00310614 predicted 1480
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023739 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00057037 predicted 3480
2 SASI_Mm01_00057038 predicted 1302
3 SASI_Mm02_00327318 predicted 461
4 SASI_Mm01_00057040 predicted 2409
5 SASI_Mm01_00057041 predicted 2802
6 SASI_Mm01_00057042 predicted 2715
7 SASI_Mm01_00057043 predicted 2517
8 SASI_Mm01_00057044 predicted 2244
9 SASI_Mm01_00057046 predicted 3465
10 SASI_Mm02_00327319 predicted 1114
11 SASI_Mm01_00057039 predicted 1269
12 SASI_Mm01_00057045 predicted 645
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023739
VALIDATED
NFX1 MISSION shRNA Bacterial Glycerol Stock
nuclear transcription factor, X-box binding 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000331786    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023739.3-3483s21c1
Sequence:CCGGGAGACTCATTTGCCAGCAGATCTCGAGATCTGCTGGCAAATGAGTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331788    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023739.3-193s21c1
Sequence:CCGGCCCAAAGAAGACTAGATTCTACTCGAGTAGAATCTAGTCTTCTTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304626    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023739.3-465s21c1
Sequence:CCGGACGTCAGATACATCTAGTTTACTCGAGTAAACTAGATGTATCTGACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304625    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023739.3-2999s21c1
Sequence:CCGGACGCTCTTCAGCATCGAAATTCTCGAGAATTTCGATGCTGAAGAGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311056    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023739.3-2149s21c1
Sequence:CCGGGATTGTGCGGACGGCATAAATCTCGAGATTTATGCCGTCCGCACAATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085123    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023739.2-3447s1c1
Sequence:CCGGGAGACTCATTTGCCAGCAGATCTCGAGATCTGCTGGCAAATGAGTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085127    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023739.2-1072s1c1
Sequence:CCGGGTTCCCTGATTGAGCAGCTAACTCGAGTTAGCTGCTCAATCAGGGAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085126    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023739.2-3066s1c1
Sequence:CCGGGCCGTGAATAAGGGCAAGAATCTCGAGATTCTTGCCCTTATTCACGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085125    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023739.2-157s1c1
Sequence:CCGGCCCAAAGAAGACTAGATTCTACTCGAGTAGAATCTAGTCTTCTTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023739.2-2076s1c1
Sequence:CCGGGCTACATTTATGTGCGACAAACTCGAGTTTGTCGCACATAAATGTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023739
VALIDATED
NFX1 MISSION shRNA shRNA Plasmid DNA
nuclear transcription factor, X-box binding 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000331786    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023739.3-3483s21c1
Sequence:CCGGGAGACTCATTTGCCAGCAGATCTCGAGATCTGCTGGCAAATGAGTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000331788    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023739.3-193s21c1
Sequence:CCGGCCCAAAGAAGACTAGATTCTACTCGAGTAGAATCTAGTCTTCTTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304626    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023739.3-465s21c1
Sequence:CCGGACGTCAGATACATCTAGTTTACTCGAGTAAACTAGATGTATCTGACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304625    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023739.3-2999s21c1
Sequence:CCGGACGCTCTTCAGCATCGAAATTCTCGAGAATTTCGATGCTGAAGAGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000311056    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023739.3-2149s21c1
Sequence:CCGGGATTGTGCGGACGGCATAAATCTCGAGATTTATGCCGTCCGCACAATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085123    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023739.2-3447s1c1
Sequence:CCGGGAGACTCATTTGCCAGCAGATCTCGAGATCTGCTGGCAAATGAGTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085127    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023739.2-1072s1c1
Sequence:CCGGGTTCCCTGATTGAGCAGCTAACTCGAGTTAGCTGCTCAATCAGGGAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085126    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023739.2-3066s1c1
Sequence:CCGGGCCGTGAATAAGGGCAAGAATCTCGAGATTCTTGCCCTTATTCACGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085125    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023739.2-157s1c1
Sequence:CCGGCCCAAAGAAGACTAGATTCTACTCGAGTAGAATCTAGTCTTCTTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023739.2-2076s1c1
Sequence:CCGGGCTACATTTATGTGCGACAAACTCGAGTTTGTCGCACATAAATGTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023739
VALIDATED
NFX1 MISSION shRNA Lentiviral Transduction Particles
nuclear transcription factor, X-box binding 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000331786    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023739.3-3483s21c1
Sequence:CCGGGAGACTCATTTGCCAGCAGATCTCGAGATCTGCTGGCAAATGAGTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331788    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023739.3-193s21c1
Sequence:CCGGCCCAAAGAAGACTAGATTCTACTCGAGTAGAATCTAGTCTTCTTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304626    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023739.3-465s21c1
Sequence:CCGGACGTCAGATACATCTAGTTTACTCGAGTAAACTAGATGTATCTGACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304625    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023739.3-2999s21c1
Sequence:CCGGACGCTCTTCAGCATCGAAATTCTCGAGAATTTCGATGCTGAAGAGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311056    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023739.3-2149s21c1
Sequence:CCGGGATTGTGCGGACGGCATAAATCTCGAGATTTATGCCGTCCGCACAATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085123    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023739.2-3447s1c1
Sequence:CCGGGAGACTCATTTGCCAGCAGATCTCGAGATCTGCTGGCAAATGAGTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085127    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023739.2-1072s1c1
Sequence:CCGGGTTCCCTGATTGAGCAGCTAACTCGAGTTAGCTGCTCAATCAGGGAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085126    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023739.2-3066s1c1
Sequence:CCGGGCCGTGAATAAGGGCAAGAATCTCGAGATTCTTGCCCTTATTCACGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085125    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023739.2-157s1c1
Sequence:CCGGCCCAAAGAAGACTAGATTCTACTCGAGTAGAATCTAGTCTTCTTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023739.2-2076s1c1
Sequence:CCGGGCTACATTTATGTGCGACAAACTCGAGTTTGTCGCACATAAATGTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002504
VALIDATED
NFX1 MISSION shRNA Bacterial Glycerol Stock
nuclear transcription factor, X-box binding 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000232108    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002504.3-260s21c1
Sequence:CCGGGCTGTTCATCAGCATAGTTATCTCGAGATAACTATGCTGATGAACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232111    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002504.3-4342s21c1
Sequence:CCGGGAATATTCCAAGTAGTATATGCTCGAGCATATACTACTTGGAATATTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232110    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002504.3-3387s21c1
Sequence:CCGGAGGAGCCAATAATTGACTATTCTCGAGAATAGTCAATTATTGGCTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232109    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002504.3-2134s21c1
Sequence:CCGGACGGTTGTGTGGACGGCATAACTCGAGTTATGCCGTCCACACAACCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257309    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002504.3-749s21c1
Sequence:CCGGGGGTATGGAGCCAGACGAAATCTCGAGATTTCGTCTGGCTCCATACCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014903    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002504.3-3779s1c1
Sequence:CCGGGCCTCAGTTGTCCCAGTTATTCTCGAGAATAACTGGGACAACTGAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014904    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_002504.3-1356s1c1
Sequence:CCGGGCAGAAATGAAATTCCACATACTCGAGTATGTGGAATTTCATTTCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014906    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_002504.3-772s1c1
Sequence:CCGGGCAGAGAAGATACCCACAGAACTCGAGTTCTGTGGGTATCTTCTCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002504.3-3089s1c1
Sequence:CCGGGCCGTGAATAAGGGAAAGAATCTCGAGATTCTTTCCCTTATTCACGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002504.3-2402s1c1
Sequence:CCGGCCAGTATATCATTCTTGTCATCTCGAGATGACAAGAATGATATACTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002504
VALIDATED
NFX1 MISSION shRNA shRNA Plasmid DNA
nuclear transcription factor, X-box binding 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000232108    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002504.3-260s21c1
Sequence:CCGGGCTGTTCATCAGCATAGTTATCTCGAGATAACTATGCTGATGAACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232111    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002504.3-4342s21c1
Sequence:CCGGGAATATTCCAAGTAGTATATGCTCGAGCATATACTACTTGGAATATTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232110    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002504.3-3387s21c1
Sequence:CCGGAGGAGCCAATAATTGACTATTCTCGAGAATAGTCAATTATTGGCTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232109    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002504.3-2134s21c1
Sequence:CCGGACGGTTGTGTGGACGGCATAACTCGAGTTATGCCGTCCACACAACCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257309    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002504.3-749s21c1
Sequence:CCGGGGGTATGGAGCCAGACGAAATCTCGAGATTTCGTCTGGCTCCATACCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014903    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002504.3-3779s1c1
Sequence:CCGGGCCTCAGTTGTCCCAGTTATTCTCGAGAATAACTGGGACAACTGAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014904    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_002504.3-1356s1c1
Sequence:CCGGGCAGAAATGAAATTCCACATACTCGAGTATGTGGAATTTCATTTCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014906    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_002504.3-772s1c1
Sequence:CCGGGCAGAGAAGATACCCACAGAACTCGAGTTCTGTGGGTATCTTCTCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002504.3-3089s1c1
Sequence:CCGGGCCGTGAATAAGGGAAAGAATCTCGAGATTCTTTCCCTTATTCACGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002504.3-2402s1c1
Sequence:CCGGCCAGTATATCATTCTTGTCATCTCGAGATGACAAGAATGATATACTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002504
VALIDATED
NFX1 MISSION shRNA Lentiviral Transduction Particles
nuclear transcription factor, X-box binding 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000232108    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002504.3-260s21c1
Sequence:CCGGGCTGTTCATCAGCATAGTTATCTCGAGATAACTATGCTGATGAACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232111    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002504.3-4342s21c1
Sequence:CCGGGAATATTCCAAGTAGTATATGCTCGAGCATATACTACTTGGAATATTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232110    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002504.3-3387s21c1
Sequence:CCGGAGGAGCCAATAATTGACTATTCTCGAGAATAGTCAATTATTGGCTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232109    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002504.3-2134s21c1
Sequence:CCGGACGGTTGTGTGGACGGCATAACTCGAGTTATGCCGTCCACACAACCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257309    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002504.3-749s21c1
Sequence:CCGGGGGTATGGAGCCAGACGAAATCTCGAGATTTCGTCTGGCTCCATACCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014903    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002504.3-3779s1c1
Sequence:CCGGGCCTCAGTTGTCCCAGTTATTCTCGAGAATAACTGGGACAACTGAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014904    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_002504.3-1356s1c1
Sequence:CCGGGCAGAAATGAAATTCCACATACTCGAGTATGTGGAATTTCATTTCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014906    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_002504.3-772s1c1
Sequence:CCGGGCAGAGAAGATACCCACAGAACTCGAGTTCTGTGGGTATCTTCTCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002504.3-3089s1c1
Sequence:CCGGGCCGTGAATAAGGGAAAGAATCTCGAGATTCTTTCCCTTATTCACGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002504.3-2402s1c1
Sequence:CCGGCCAGTATATCATTCTTGTCATCTCGAGATGACAAGAATGATATACTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)