EMAIL THIS PAGE TO A FRIEND

NFYA

nuclear transcription factor Y, alpha

156 Gene Product Result for
Synonyms: CBF-A CBF-B HAP2 NF-YA
UniProtKB ID: P23511, Q8IXU0
Gene ID:
Human(4800) Summary: The protein encoded by this gene is one subunit of a trimeric complex, forming a highly conserved transcription factor that binds to CCAAT motifs in the promoter regions in a variety of genes. Subunit A associates with a tight dimer composed of the B and C subunits, resulting in a trimer that binds to DNA with high specificity and affinity. The sequence specific interactions of the complex are made by the A subunit, suggesting a role as the regulatory subunit. In addition, there is evidence of post-transcriptional regulation in this gene product, either by protein degradation or control of translation. Further regulation is represented by alternative splicing in the glutamine-rich activation domain, with clear tissue-specific preferences for the two isoforms. [provided by RefSeq, Jul 2008]
Mouse(18044) nuclear transcription factor-Y alpha
Rat(29508) nuclear transcription factor-Y alpha
Zebrafish(83915) nuclear transcription factor Y, alpha
chicken(419917) nuclear transcription factor Y, alpha
cow(539584) nuclear transcription factor Y, alpha
Horse(100054237) nuclear transcription factor Y, alpha
domestic cat(101098871) nuclear transcription factor Y, alpha
dog(474897) nuclear transcription factor Y, alpha
naked mole-rat(101717746) nuclear transcription factor Y, alpha
domestic guinea pig(100717576) nuclear transcription factor Y, alpha
sheep(101104434) nuclear transcription factor Y, alpha
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1100079 Anti-NFYA (266-280) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
AV31380 Anti-NFYA (AB2) antibody produced in rabbit affinity isolated antibody guinea pig, horse, human, mouse, rat, bovine, canine, rabbit
immunohistochemistry, western blot pricing
AV31263 Anti-NFYA antibody produced in rabbit IgG fraction of antiserum canine, rat, bovine, human, horse, guinea pig, yeast, mouse, rabbit
immunohistochemistry, western blot pricing
HPA050779 Anti-NFYA antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
SAB4502001 Anti-NFYA, C-Terminal antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002505 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002505 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002505 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010913 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010913 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010913 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU134141 MISSION® esiRNA esiRNA human NFYA (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002505 Rosetta Predictions human pricing
NM_021705 Rosetta Predictions human pricing
NM_012865 Rosetta Predictions rat pricing
NM_001110832 Rosetta Predictions mouse pricing
NM_010913 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002505 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00183592 predicted 1179
2 SASI_Hs01_00183593 predicted 1196
3 SASI_Hs01_00183594 predicted 1312
4 SASI_Hs01_00183595 predicted 1020
5 SASI_Hs01_00183596 predicted 1307
6 SASI_Hs01_00183597 predicted 974
7 SASI_Hs02_00333967 predicted 984
8 SASI_Hs01_00183599 predicted 1278
9 SASI_Hs01_00183600 predicted 1254
10 SASI_Hs01_00183601 predicted 1183
11 SASI_Hs01_00183598 predicted 1057
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021705 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00020331 predicted 1093
2 SASI_Hs01_00020332 predicted 1105
3 SASI_Hs01_00020333 predicted 1222
4 SASI_Hs01_00020334 predicted 929
5 SASI_Hs01_00020335 predicted 1211
6 SASI_Hs01_00020336 predicted 890
7 SASI_Hs02_00355031 predicted 899
8 SASI_Hs01_00020338 predicted 1191
9 SASI_Hs01_00020339 predicted 1166
10 SASI_Hs01_00020340 predicted 1098
11 SASI_Hs01_00020337 predicted 977
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012865 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00084038 predicted 957
2 SASI_Rn01_00084039 predicted 434
3 SASI_Rn01_00084040 predicted 1174
4 SASI_Rn01_00084041 predicted 466
5 SASI_Rn01_00084042 predicted 342
6 SASI_Rn01_00084043 predicted 851
7 SASI_Rn02_00260350 predicted 1026
8 SASI_Rn01_00084044 predicted 678
9 SASI_Rn01_00084045 predicted 931
10 SASI_Rn01_00084046 predicted 1122
11 SASI_Rn01_00084047 predicted 699
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001110832 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00305878 predicted 1066
2 SASI_Mm02_00305879 predicted 954
3 SASI_Mm02_00305880 predicted 754
4 SASI_Mm02_00305881 predicted 1279
5 SASI_Mm02_00305882 predicted 1414
6 SASI_Mm02_00305883 predicted 766
7 SASI_Mm02_00305884 predicted 1578
8 SASI_Mm02_00305885 predicted 791
9 SASI_Mm02_00305886 predicted 770
10 SASI_Mm02_00305887 predicted 1502
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010913 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00319646 predicted 981
2 SASI_Mm01_00073187 predicted 868
3 SASI_Mm01_00073189 predicted 668
4 SASI_Mm01_00073190 predicted 1194
5 SASI_Mm02_00319647 predicted 1320
6 SASI_Mm01_00073191 predicted 680
7 SASI_Mm02_00319648 predicted 1497
8 SASI_Mm01_00073192 predicted 696
9 SASI_Mm01_00073195 predicted 688
10 SASI_Mm02_00319649 predicted 1421
11 SASI_Mm01_00073186 predicted 380
12 SASI_Mm01_00073188 predicted 355
13 SASI_Mm01_00073193 predicted 257
14 SASI_Mm01_00073194 predicted 469
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002505
VALIDATED
NFYA MISSION shRNA Bacterial Glycerol Stock
nuclear transcription factor Y, alpha
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436324    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002505.4-1421s21c1
Sequence:CCGGCTTTCAGTCAGGACCTATTTCCTCGAGGAAATAGGTCCTGACTGAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420871    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002505.4-710s21c1
Sequence:CCGGACCATTCTCCAGCAAGTTACACTCGAGTGTAACTTGCTGGAGAATGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424690    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002505.4-391s21c1
Sequence:CCGGATCAACTGGCCAACCCATCATCTCGAGATGATGGGTTGGCCAGTTGATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413104    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002505.4-340s21c1
Sequence:CCGGAGTCCAAGGGCAGCCATTAATCTCGAGATTAATGGCTGCCCTTGGACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431656    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002505.4-204s21c1
Sequence:CCGGATAGTTCGACAGAGCAGATTGCTCGAGCAATCTGCTCTGTCGAACTATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431625    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002505.4-1169s21c1
Sequence:CCGGGATCCAAACCAAGCCGATGAACTCGAGTTCATCGGCTTGGTTTGGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014929    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002505.3-981s1c1
Sequence:CCGGGCCAAACAATACCACCGTATTCTCGAGAATACGGTGGTATTGTTTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014930    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A3
TRC Version: 1 Clone ID:NM_002505.3-676s1c1
Sequence:CCGGCCATCGTCTATCAACCAGTTACTCGAGTAACTGGTTGATAGACGATGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002505.3-1020s1c1
Sequence:CCGGCGAGCTAAACTAGAGGCAGAACTCGAGTTCTGCCTCTAGTTTAGCTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002505.3-442s1c1
Sequence:CCGGCCATCATGCAAGTACCTGTTTCTCGAGAAACAGGTACTTGCATGATGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002505
VALIDATED
NFYA MISSION shRNA shRNA Plasmid DNA
nuclear transcription factor Y, alpha
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436324    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002505.4-1421s21c1
Sequence:CCGGCTTTCAGTCAGGACCTATTTCCTCGAGGAAATAGGTCCTGACTGAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420871    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002505.4-710s21c1
Sequence:CCGGACCATTCTCCAGCAAGTTACACTCGAGTGTAACTTGCTGGAGAATGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424690    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002505.4-391s21c1
Sequence:CCGGATCAACTGGCCAACCCATCATCTCGAGATGATGGGTTGGCCAGTTGATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413104    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002505.4-340s21c1
Sequence:CCGGAGTCCAAGGGCAGCCATTAATCTCGAGATTAATGGCTGCCCTTGGACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431656    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002505.4-204s21c1
Sequence:CCGGATAGTTCGACAGAGCAGATTGCTCGAGCAATCTGCTCTGTCGAACTATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431625    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002505.4-1169s21c1
Sequence:CCGGGATCCAAACCAAGCCGATGAACTCGAGTTCATCGGCTTGGTTTGGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014929    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002505.3-981s1c1
Sequence:CCGGGCCAAACAATACCACCGTATTCTCGAGAATACGGTGGTATTGTTTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014930    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A3
TRC Version: 1 Clone ID:NM_002505.3-676s1c1
Sequence:CCGGCCATCGTCTATCAACCAGTTACTCGAGTAACTGGTTGATAGACGATGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002505.3-1020s1c1
Sequence:CCGGCGAGCTAAACTAGAGGCAGAACTCGAGTTCTGCCTCTAGTTTAGCTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002505.3-442s1c1
Sequence:CCGGCCATCATGCAAGTACCTGTTTCTCGAGAAACAGGTACTTGCATGATGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002505
VALIDATED
NFYA MISSION shRNA Lentiviral Transduction Particles
nuclear transcription factor Y, alpha
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436324    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002505.4-1421s21c1
Sequence:CCGGCTTTCAGTCAGGACCTATTTCCTCGAGGAAATAGGTCCTGACTGAAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420871    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002505.4-710s21c1
Sequence:CCGGACCATTCTCCAGCAAGTTACACTCGAGTGTAACTTGCTGGAGAATGGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424690    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002505.4-391s21c1
Sequence:CCGGATCAACTGGCCAACCCATCATCTCGAGATGATGGGTTGGCCAGTTGATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413104    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002505.4-340s21c1
Sequence:CCGGAGTCCAAGGGCAGCCATTAATCTCGAGATTAATGGCTGCCCTTGGACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431656    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002505.4-204s21c1
Sequence:CCGGATAGTTCGACAGAGCAGATTGCTCGAGCAATCTGCTCTGTCGAACTATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431625    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002505.4-1169s21c1
Sequence:CCGGGATCCAAACCAAGCCGATGAACTCGAGTTCATCGGCTTGGTTTGGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014929    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002505.3-981s1c1
Sequence:CCGGGCCAAACAATACCACCGTATTCTCGAGAATACGGTGGTATTGTTTGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014930    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A3
TRC Version: 1 Clone ID:NM_002505.3-676s1c1
Sequence:CCGGCCATCGTCTATCAACCAGTTACTCGAGTAACTGGTTGATAGACGATGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002505.3-1020s1c1
Sequence:CCGGCGAGCTAAACTAGAGGCAGAACTCGAGTTCTGCCTCTAGTTTAGCTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002505.3-442s1c1
Sequence:CCGGCCATCATGCAAGTACCTGTTTCTCGAGAAACAGGTACTTGCATGATGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010913
VALIDATED
NFYA MISSION shRNA Bacterial Glycerol Stock
nuclear transcription factor Y, alpha
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000331581    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010913.2-1170s21c1
Sequence:CCGGCCAAACCAAGCTGACGAAGAACTCGAGTTCTTCGTCAGCTTGGTTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331757    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010913.2-996s21c1
Sequence:CCGGCGCATCCTTAAGAGGAGACAACTCGAGTTGTCTCCTCTTAAGGATGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331510    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010913.2-706s21c1
Sequence:CCGGGCACAATTCTCCAGCAAGTTACTCGAGTAACTTGCTGGAGAATTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301788    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010913.2-1399s21c1
Sequence:CCGGCCCTTCATTGAGGATCTGTTTCTCGAGAAACAGATCCTCAATGAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084438    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010913.1-1309s1c1
Sequence:CCGGCCCTTCATTGAGGATCTGTTTCTCGAGAAACAGATCCTCAATGAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084441    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010913.1-1080s1c1
Sequence:CCGGCCAAACCAAGCTGACGAAGAACTCGAGTTCTTCGTCAGCTTGGTTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084442    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010913.1-906s1c1
Sequence:CCGGCGCATCCTTAAGAGGAGACAACTCGAGTTGTCTCCTCTTAAGGATGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010913.1-616s1c1
Sequence:CCGGGCACAATTCTCCAGCAAGTTACTCGAGTAACTTGCTGGAGAATTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010913.1-628s1c1
Sequence:CCGGAGCAAGTTACAGTCCCTGTTTCTCGAGAAACAGGGACTGTAACTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010913
VALIDATED
NFYA MISSION shRNA shRNA Plasmid DNA
nuclear transcription factor Y, alpha
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000331581    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010913.2-1170s21c1
Sequence:CCGGCCAAACCAAGCTGACGAAGAACTCGAGTTCTTCGTCAGCTTGGTTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000331757    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010913.2-996s21c1
Sequence:CCGGCGCATCCTTAAGAGGAGACAACTCGAGTTGTCTCCTCTTAAGGATGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000331510    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010913.2-706s21c1
Sequence:CCGGGCACAATTCTCCAGCAAGTTACTCGAGTAACTTGCTGGAGAATTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000301788    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010913.2-1399s21c1
Sequence:CCGGCCCTTCATTGAGGATCTGTTTCTCGAGAAACAGATCCTCAATGAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084438    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010913.1-1309s1c1
Sequence:CCGGCCCTTCATTGAGGATCTGTTTCTCGAGAAACAGATCCTCAATGAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084441    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010913.1-1080s1c1
Sequence:CCGGCCAAACCAAGCTGACGAAGAACTCGAGTTCTTCGTCAGCTTGGTTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084442    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010913.1-906s1c1
Sequence:CCGGCGCATCCTTAAGAGGAGACAACTCGAGTTGTCTCCTCTTAAGGATGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010913.1-616s1c1
Sequence:CCGGGCACAATTCTCCAGCAAGTTACTCGAGTAACTTGCTGGAGAATTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010913.1-628s1c1
Sequence:CCGGAGCAAGTTACAGTCCCTGTTTCTCGAGAAACAGGGACTGTAACTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010913
VALIDATED
NFYA MISSION shRNA Lentiviral Transduction Particles
nuclear transcription factor Y, alpha
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000331581    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010913.2-1170s21c1
Sequence:CCGGCCAAACCAAGCTGACGAAGAACTCGAGTTCTTCGTCAGCTTGGTTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331757    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010913.2-996s21c1
Sequence:CCGGCGCATCCTTAAGAGGAGACAACTCGAGTTGTCTCCTCTTAAGGATGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331510    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010913.2-706s21c1
Sequence:CCGGGCACAATTCTCCAGCAAGTTACTCGAGTAACTTGCTGGAGAATTGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301788    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010913.2-1399s21c1
Sequence:CCGGCCCTTCATTGAGGATCTGTTTCTCGAGAAACAGATCCTCAATGAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084438    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010913.1-1309s1c1
Sequence:CCGGCCCTTCATTGAGGATCTGTTTCTCGAGAAACAGATCCTCAATGAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084441    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010913.1-1080s1c1
Sequence:CCGGCCAAACCAAGCTGACGAAGAACTCGAGTTCTTCGTCAGCTTGGTTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084442    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010913.1-906s1c1
Sequence:CCGGCGCATCCTTAAGAGGAGACAACTCGAGTTGTCTCCTCTTAAGGATGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010913.1-616s1c1
Sequence:CCGGGCACAATTCTCCAGCAAGTTACTCGAGTAACTTGCTGGAGAATTGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010913.1-628s1c1
Sequence:CCGGAGCAAGTTACAGTCCCTGTTTCTCGAGAAACAGGGACTGTAACTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)