EMAIL THIS PAGE TO A FRIEND

NFYB

nuclear transcription factor Y, beta

144 Gene Product Result for
Synonyms: CBF-A CBF-B HAP3 NF-YB
UniProtKB ID: P25208, A8K7B9, Q96IY8
Gene ID:
Human(4801) Summary: The protein encoded by this gene is one subunit of a trimeric complex, forming a highly conserved transcription factor that binds with high specificity to CCAAT motifs in the promoter regions in a variety of genes. This gene product, subunit B, forms a tight dimer with the C subunit, a prerequisite for subunit A association. The resulting trimer binds to DNA with high specificity and affinity. Subunits B and C each contain a histone-like motif. Observation of the histone nature of these subunits is supported by two types of evidence; protein sequence alignments and experiments with mutants. [provided by RefSeq, Jul 2008]
Mouse(18045) nuclear transcription factor-Y beta
Rat(25336) nuclear transcription factor-Y beta
chicken(396205) nuclear transcription factor Y, beta
dog(475450) nuclear transcription factor Y, beta
Horse(100034044) nuclear transcription factor Y, beta
cow(614382) nuclear transcription factor Y, beta
domestic cat(101083016) nuclear transcription factor Y, beta
sheep(101112718) nuclear transcription factor Y, beta
domestic guinea pig(100723212) nuclear transcription factor Y, beta
naked mole-rat(101700745) nuclear transcription factor Y, beta
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010914 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010914 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010914 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006166 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006166 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006166 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006166 Rosetta Predictions human pricing
NM_031553 Rosetta Predictions rat pricing
NM_010914 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006166 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00341024 predicted 886
2 SASI_Hs01_00163465 predicted 355
3 SASI_Hs02_00341025 predicted 310
4 SASI_Hs01_00163466 predicted 246
5 SASI_Hs01_00163467 predicted 689
6 SASI_Hs01_00163468 predicted 511
7 SASI_Hs01_00163469 predicted 693
8 SASI_Hs01_00163471 predicted 760
9 SASI_Hs01_00163472 predicted 753
10 SASI_Hs01_00163473 predicted 292
11 SASI_Hs01_00163470 predicted 504
12 SASI_Hs01_00163474 predicted 369
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031553 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00066826 predicted 553
2 SASI_Rn02_00264743 predicted 475
3 SASI_Rn01_00066827 predicted 727
4 SASI_Rn02_00264744 predicted 450
5 SASI_Rn01_00066829 predicted 773
6 SASI_Rn01_00066831 predicted 595
7 SASI_Rn01_00066832 predicted 496
8 SASI_Rn01_00066833 predicted 389
9 SASI_Rn01_00066834 predicted 424
10 SASI_Rn02_00264745 predicted 518
11 SASI_Rn01_00066828 predicted 711
12 SASI_Rn01_00066830 predicted 712
13 SASI_Rn01_00066835 predicted 269
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010914 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00112404 predicted 681
2 SASI_Mm01_00112405 predicted 705
3 SASI_Mm01_00112406 predicted 557
4 SASI_Mm01_00112407 predicted 674
5 SASI_Mm01_00112408 predicted 478
6 SASI_Mm02_00319650 predicted 524
7 SASI_Mm01_00112409 predicted 690
8 SASI_Mm01_00112410 predicted 255
9 SASI_Mm01_00112411 predicted 766
10 SASI_Mm01_00112413 predicted 784
11 SASI_Mm01_00112412 predicted 257
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010914
VALIDATED
NFYB MISSION shRNA Bacterial Glycerol Stock
nuclear transcription factor Y, beta
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000349712    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010914.2-731s21c1
Sequence:CCGGAGTTACCAGCTGGCTTAATAACTCGAGTTATTAAGCCAGCTGGTAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312855    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010914.2-967s21c1
Sequence:CCGGTTGACTAATTGAGGTGTTAATCTCGAGATTAACACCTCAATTAGTCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084488    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010914.1-1068s1c1
Sequence:CCGGCGAGAGTTTGTTGCTCTGTATCTCGAGATACAGAGCAACAAACTCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084490    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010914.1-454s1c1
Sequence:CCGGCCAAAGAATGTGTTCAGGAATCTCGAGATTCCTGAACACATTCTTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010914.1-782s1c1
Sequence:CCGGCACAACGTCTTACCAACAGATCTCGAGATCTGTTGGTAAGACGTTGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010914.1-735s1c1
Sequence:CCGGGCTGGCTTAATAACTGCAGATCTCGAGATCTGCAGTTATTAAGCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010914.1-251s1c1
Sequence:CCGGGCTAGGGATTTCTGCAGACTACTCGAGTAGTCTGCAGAAATCCCTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312834    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010914.2-274s21c1
Sequence:CCGGTACATCGGAGGAAGTCATTATCTCGAGATAATGACTTCCTCCGATGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312787    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010914.2-788s21c1
Sequence:CCGGCAACGTCTTACCAACAGATTTCTCGAGAAATCTGTTGGTAAGACGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311789    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010914.2-458s21c1
Sequence:CCGGCCAAAGAATGTGTTCAGGAATCTCGAGATTCCTGAACACATTCTTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010914
VALIDATED
NFYB MISSION shRNA shRNA Plasmid DNA
nuclear transcription factor Y, beta
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000349712    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010914.2-731s21c1
Sequence:CCGGAGTTACCAGCTGGCTTAATAACTCGAGTTATTAAGCCAGCTGGTAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312855    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010914.2-967s21c1
Sequence:CCGGTTGACTAATTGAGGTGTTAATCTCGAGATTAACACCTCAATTAGTCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084488    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010914.1-1068s1c1
Sequence:CCGGCGAGAGTTTGTTGCTCTGTATCTCGAGATACAGAGCAACAAACTCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084490    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010914.1-454s1c1
Sequence:CCGGCCAAAGAATGTGTTCAGGAATCTCGAGATTCCTGAACACATTCTTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010914.1-782s1c1
Sequence:CCGGCACAACGTCTTACCAACAGATCTCGAGATCTGTTGGTAAGACGTTGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010914.1-735s1c1
Sequence:CCGGGCTGGCTTAATAACTGCAGATCTCGAGATCTGCAGTTATTAAGCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010914.1-251s1c1
Sequence:CCGGGCTAGGGATTTCTGCAGACTACTCGAGTAGTCTGCAGAAATCCCTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312834    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010914.2-274s21c1
Sequence:CCGGTACATCGGAGGAAGTCATTATCTCGAGATAATGACTTCCTCCGATGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312787    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010914.2-788s21c1
Sequence:CCGGCAACGTCTTACCAACAGATTTCTCGAGAAATCTGTTGGTAAGACGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000311789    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010914.2-458s21c1
Sequence:CCGGCCAAAGAATGTGTTCAGGAATCTCGAGATTCCTGAACACATTCTTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010914
VALIDATED
NFYB MISSION shRNA Lentiviral Transduction Particles
nuclear transcription factor Y, beta
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000349712    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010914.2-731s21c1
Sequence:CCGGAGTTACCAGCTGGCTTAATAACTCGAGTTATTAAGCCAGCTGGTAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312855    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010914.2-967s21c1
Sequence:CCGGTTGACTAATTGAGGTGTTAATCTCGAGATTAACACCTCAATTAGTCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084488    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010914.1-1068s1c1
Sequence:CCGGCGAGAGTTTGTTGCTCTGTATCTCGAGATACAGAGCAACAAACTCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084490    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010914.1-454s1c1
Sequence:CCGGCCAAAGAATGTGTTCAGGAATCTCGAGATTCCTGAACACATTCTTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010914.1-782s1c1
Sequence:CCGGCACAACGTCTTACCAACAGATCTCGAGATCTGTTGGTAAGACGTTGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010914.1-735s1c1
Sequence:CCGGGCTGGCTTAATAACTGCAGATCTCGAGATCTGCAGTTATTAAGCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010914.1-251s1c1
Sequence:CCGGGCTAGGGATTTCTGCAGACTACTCGAGTAGTCTGCAGAAATCCCTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312834    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010914.2-274s21c1
Sequence:CCGGTACATCGGAGGAAGTCATTATCTCGAGATAATGACTTCCTCCGATGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312787    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010914.2-788s21c1
Sequence:CCGGCAACGTCTTACCAACAGATTTCTCGAGAAATCTGTTGGTAAGACGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311789    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010914.2-458s21c1
Sequence:CCGGCCAAAGAATGTGTTCAGGAATCTCGAGATTCCTGAACACATTCTTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006166
VALIDATED
NFYB MISSION shRNA Bacterial Glycerol Stock
nuclear transcription factor Y, beta
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000285137    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_006166.3-719s21c1
Sequence:CCGGAGTTACCAGCTGGCTTAATAACTCGAGTTATTAAGCCAGCTGGTAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285140    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006166.3-384s21c1
Sequence:CCGGAGCAAACGTGGCTAGGATAATCTCGAGATTATCCTAGCCACGTTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274068    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006166.3-960s21c1
Sequence:CCGGTTGACTAATTGAGGTGTTAATCTCGAGATTAACACCTCAATTAGTCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274128    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006166.3-446s21c1
Sequence:CCGGCCAAAGAATGTGTTCAAGAATCTCGAGATTCTTGAACACATTCTTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285134    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_006166.3-247s21c1
Sequence:CCGGGGAATCTCTGCAGACTATATTCTCGAGAATATAGTCTGCAGAGATTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014954    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006166.3-446s1c1
Sequence:CCGGCCAAAGAATGTGTTCAAGAATCTCGAGATTCTTGAACACATTCTTTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014957    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_006166.3-774s1c1
Sequence:CCGGCACAACATCATATCAACAGATCTCGAGATCTGTTGATATGATGTTGTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014955    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006166.3-562s1c1
Sequence:CCGGGCTATGTCTACTTTAGGCTTTCTCGAGAAAGCCTAAAGTAGACATAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014956    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_006166.3-502s1c1
Sequence:CCGGGCAAGTGAAAGGTGCCATCAACTCGAGTTGATGGCACCTTTCACTTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014953    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006166.3-2399s1c1
Sequence:CCGGGCTCATATTGTGCATACCATTCTCGAGAATGGTATGCACAATATGAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006166
VALIDATED
NFYB MISSION shRNA shRNA Plasmid DNA
nuclear transcription factor Y, beta
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000285137    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_006166.3-719s21c1
Sequence:CCGGAGTTACCAGCTGGCTTAATAACTCGAGTTATTAAGCCAGCTGGTAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000285140    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006166.3-384s21c1
Sequence:CCGGAGCAAACGTGGCTAGGATAATCTCGAGATTATCCTAGCCACGTTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274068    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006166.3-960s21c1
Sequence:CCGGTTGACTAATTGAGGTGTTAATCTCGAGATTAACACCTCAATTAGTCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274128    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006166.3-446s21c1
Sequence:CCGGCCAAAGAATGTGTTCAAGAATCTCGAGATTCTTGAACACATTCTTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000285134    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_006166.3-247s21c1
Sequence:CCGGGGAATCTCTGCAGACTATATTCTCGAGAATATAGTCTGCAGAGATTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014954    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006166.3-446s1c1
Sequence:CCGGCCAAAGAATGTGTTCAAGAATCTCGAGATTCTTGAACACATTCTTTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014957    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_006166.3-774s1c1
Sequence:CCGGCACAACATCATATCAACAGATCTCGAGATCTGTTGATATGATGTTGTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014955    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006166.3-562s1c1
Sequence:CCGGGCTATGTCTACTTTAGGCTTTCTCGAGAAAGCCTAAAGTAGACATAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014956    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_006166.3-502s1c1
Sequence:CCGGGCAAGTGAAAGGTGCCATCAACTCGAGTTGATGGCACCTTTCACTTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014953    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006166.3-2399s1c1
Sequence:CCGGGCTCATATTGTGCATACCATTCTCGAGAATGGTATGCACAATATGAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006166
VALIDATED
NFYB MISSION shRNA Lentiviral Transduction Particles
nuclear transcription factor Y, beta
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000285137    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_006166.3-719s21c1
Sequence:CCGGAGTTACCAGCTGGCTTAATAACTCGAGTTATTAAGCCAGCTGGTAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285140    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006166.3-384s21c1
Sequence:CCGGAGCAAACGTGGCTAGGATAATCTCGAGATTATCCTAGCCACGTTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274068    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006166.3-960s21c1
Sequence:CCGGTTGACTAATTGAGGTGTTAATCTCGAGATTAACACCTCAATTAGTCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274128    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006166.3-446s21c1
Sequence:CCGGCCAAAGAATGTGTTCAAGAATCTCGAGATTCTTGAACACATTCTTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285134    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_006166.3-247s21c1
Sequence:CCGGGGAATCTCTGCAGACTATATTCTCGAGAATATAGTCTGCAGAGATTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014954    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006166.3-446s1c1
Sequence:CCGGCCAAAGAATGTGTTCAAGAATCTCGAGATTCTTGAACACATTCTTTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014957    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_006166.3-774s1c1
Sequence:CCGGCACAACATCATATCAACAGATCTCGAGATCTGTTGATATGATGTTGTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014955    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006166.3-562s1c1
Sequence:CCGGGCTATGTCTACTTTAGGCTTTCTCGAGAAAGCCTAAAGTAGACATAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014956    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_006166.3-502s1c1
Sequence:CCGGGCAAGTGAAAGGTGCCATCAACTCGAGTTGATGGCACCTTTCACTTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014953    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006166.3-2399s1c1
Sequence:CCGGGCTCATATTGTGCATACCATTCTCGAGAATGGTATGCACAATATGAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)