EMAIL THIS PAGE TO A FRIEND

NFYC

nuclear transcription factor Y, gamma

90 Gene Product Result for
Synonyms: CBF-C CBFC H1TF2A HAP5 HSM NF-YC
Gene ID:
Human(4802) Summary: This gene encodes one subunit of a trimeric complex forming a highly conserved transcription factor that binds with high specificity to CCAAT motifs in the promoters of a variety of genes. The encoded protein, subunit C, forms a tight dimer with the B subunit, a prerequisite for subunit A association. The resulting trimer binds to DNA with high specificity and affinity. Subunits B and C each contain a histone-like motif. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2008]
Mouse(18046) nuclear transcription factor-Y gamma
Rat(25337) nuclear transcription factor-Y gamma
Zebrafish(323445) nuclear transcription factor Y, gamma
chicken(419642) nuclear transcription factor Y, gamma
dog(475312) nuclear transcription factor Y, gamma
domestic cat(101099313) nuclear transcription factor Y, gamma
cow(534003) nuclear transcription factor Y, gamma
Horse(100053895) nuclear transcription factor Y, gamma
naked mole-rat(101712987) nuclear transcription factor Y, gamma
domestic guinea pig(100715361) nuclear transcription factor Y, gamma
sheep(101102681) nuclear transcription factor Y, gamma
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008692 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008692 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008692 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014223 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014223 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014223 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014223 Rosetta Predictions human pricing
NM_012866 Rosetta Predictions rat pricing
NM_001048168 Rosetta Predictions mouse pricing
NM_008692 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014223 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00181221 predicted 950
2 SASI_Hs01_00181222 predicted 765
3 SASI_Hs01_00181223 predicted 1076
4 SASI_Hs01_00181224 predicted 385
5 SASI_Hs01_00181225 predicted 686
6 SASI_Hs01_00181226 predicted 855
7 SASI_Hs01_00181227 predicted 577
8 SASI_Hs01_00181228 predicted 482
9 SASI_Hs01_00181229 predicted 1110
10 SASI_Hs01_00181230 predicted 1082
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012866 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00060942 predicted 939
2 SASI_Rn01_00060943 predicted 472
3 SASI_Rn01_00060944 predicted 927
4 SASI_Rn01_00060945 predicted 271
5 SASI_Rn01_00060946 predicted 720
6 SASI_Rn01_00060947 predicted 868
7 SASI_Rn01_00060948 predicted 320
8 SASI_Rn01_00060949 predicted 1027
9 SASI_Rn01_00060950 predicted 429
10 SASI_Rn01_00060951 predicted 293
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001048168 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00292100 predicted 419
2 SASI_Mm02_00292101 predicted 1003
3 SASI_Mm02_00292102 predicted 663
4 SASI_Mm02_00292103 predicted 958
5 SASI_Mm02_00292104 predicted 946
6 SASI_Mm02_00292105 predicted 916
7 SASI_Mm02_00292106 predicted 482
8 SASI_Mm02_00292107 predicted 625
9 SASI_Mm02_00292108 predicted 708
10 SASI_Mm02_00292109 predicted 821
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008692 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00043194 predicted 470
2 SASI_Mm01_00043197 predicted 1051
3 SASI_Mm01_00043199 predicted 715
4 SASI_Mm02_00314503 predicted 1007
5 SASI_Mm02_00314504 predicted 993
6 SASI_Mm01_00043200 predicted 963
7 SASI_Mm01_00043201 predicted 535
8 SASI_Mm02_00314505 predicted 682
9 SASI_Mm01_00043202 predicted 757
10 SASI_Mm02_00314506 predicted 867
11 SASI_Mm01_00043195 predicted 244
12 SASI_Mm01_00043196 predicted 813
13 SASI_Mm01_00043198 predicted 220
14 SASI_Mm01_00043203 predicted 417
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008692
VALIDATED
NFYC MISSION shRNA Bacterial Glycerol Stock
nuclear transcription factor Y, gamma
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000331582    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008692.3-471s21c1
Sequence:CCGGCGTCGTACTCTTCAGAGGAATCTCGAGATTCCTCTGAAGAGTACGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304511    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008692.3-1225s21c1
Sequence:CCGGGGACACCCAACACGATATTTGCTCGAGCAAATATCGTGTTGGGTGTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301790    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008692.3-932s21c1
Sequence:CCGGCCAGCTGCAATATATCCGATTCTCGAGAATCGGATATATTGCAGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331512    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008692.3-263s21c1
Sequence:CCGGGCCCAGAGTCATGGAAGAAATCTCGAGATTTCTTCCATGACTCTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304569    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008692.3-525s21c1
Sequence:CCGGTTCGACTTTCTCATCGATATTCTCGAGAATATCGATGAGAAAGTCGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084538    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008692.2-1654s1c1
Sequence:CCGGCCAGAAGATGTGGAAACATTTCTCGAGAAATGTTTCCACATCTTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084541    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008692.2-423s1c1
Sequence:CCGGCGTCGTACTCTTCAGAGGAATCTCGAGATTCCTCTGAAGAGTACGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084542    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008692.2-884s1c1
Sequence:CCGGCCAGCTGCAATATATCCGATTCTCGAGAATCGGATATATTGCAGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084540    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008692.2-426s1c1
Sequence:CCGGCGTACTCTTCAGAGGAATGATCTCGAGATCATTCCTCTGAAGAGTACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084539    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008692.2-215s1c1
Sequence:CCGGGCCCAGAGTCATGGAAGAAATCTCGAGATTTCTTCCATGACTCTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008692
VALIDATED
NFYC MISSION shRNA shRNA Plasmid DNA
nuclear transcription factor Y, gamma
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000331582    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008692.3-471s21c1
Sequence:CCGGCGTCGTACTCTTCAGAGGAATCTCGAGATTCCTCTGAAGAGTACGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304511    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008692.3-1225s21c1
Sequence:CCGGGGACACCCAACACGATATTTGCTCGAGCAAATATCGTGTTGGGTGTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000301790    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008692.3-932s21c1
Sequence:CCGGCCAGCTGCAATATATCCGATTCTCGAGAATCGGATATATTGCAGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000331512    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008692.3-263s21c1
Sequence:CCGGGCCCAGAGTCATGGAAGAAATCTCGAGATTTCTTCCATGACTCTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304569    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008692.3-525s21c1
Sequence:CCGGTTCGACTTTCTCATCGATATTCTCGAGAATATCGATGAGAAAGTCGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084538    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008692.2-1654s1c1
Sequence:CCGGCCAGAAGATGTGGAAACATTTCTCGAGAAATGTTTCCACATCTTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084541    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008692.2-423s1c1
Sequence:CCGGCGTCGTACTCTTCAGAGGAATCTCGAGATTCCTCTGAAGAGTACGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084542    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008692.2-884s1c1
Sequence:CCGGCCAGCTGCAATATATCCGATTCTCGAGAATCGGATATATTGCAGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084540    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008692.2-426s1c1
Sequence:CCGGCGTACTCTTCAGAGGAATGATCTCGAGATCATTCCTCTGAAGAGTACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084539    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008692.2-215s1c1
Sequence:CCGGGCCCAGAGTCATGGAAGAAATCTCGAGATTTCTTCCATGACTCTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008692
VALIDATED
NFYC MISSION shRNA Lentiviral Transduction Particles
nuclear transcription factor Y, gamma
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000331582    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008692.3-471s21c1
Sequence:CCGGCGTCGTACTCTTCAGAGGAATCTCGAGATTCCTCTGAAGAGTACGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304511    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008692.3-1225s21c1
Sequence:CCGGGGACACCCAACACGATATTTGCTCGAGCAAATATCGTGTTGGGTGTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301790    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008692.3-932s21c1
Sequence:CCGGCCAGCTGCAATATATCCGATTCTCGAGAATCGGATATATTGCAGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331512    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008692.3-263s21c1
Sequence:CCGGGCCCAGAGTCATGGAAGAAATCTCGAGATTTCTTCCATGACTCTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304569    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008692.3-525s21c1
Sequence:CCGGTTCGACTTTCTCATCGATATTCTCGAGAATATCGATGAGAAAGTCGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084538    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008692.2-1654s1c1
Sequence:CCGGCCAGAAGATGTGGAAACATTTCTCGAGAAATGTTTCCACATCTTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084541    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008692.2-423s1c1
Sequence:CCGGCGTCGTACTCTTCAGAGGAATCTCGAGATTCCTCTGAAGAGTACGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084542    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008692.2-884s1c1
Sequence:CCGGCCAGCTGCAATATATCCGATTCTCGAGAATCGGATATATTGCAGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084540    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008692.2-426s1c1
Sequence:CCGGCGTACTCTTCAGAGGAATGATCTCGAGATCATTCCTCTGAAGAGTACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084539    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008692.2-215s1c1
Sequence:CCGGGCCCAGAGTCATGGAAGAAATCTCGAGATTTCTTCCATGACTCTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014223
VALIDATED
NFYC MISSION shRNA Bacterial Glycerol Stock
nuclear transcription factor Y, gamma
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000274071    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014223.4-723s21c1
Sequence:CCGGCGAGCCAGTCCAGTACTATTTCTCGAGAAATAGTACTGGACTGGCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274072    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_014223.4-556s21c1
Sequence:CCGGGCCTGGATTCACACAGAAGATCTCGAGATCTTCTGTGTGAATCCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274070    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_014223.4-602s21c1
Sequence:CCGGATGATATCGCCATGGCAATTACTCGAGTAATTGCCATGGCGATATCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274131    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_014223.4-386s21c1
Sequence:CCGGTGGAAGAAATCCGGAATTTAACTCGAGTTAAATTCCGGATTTCTTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274069    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_014223.4-1768s21c1
Sequence:CCGGCCTCAGATGGAATTAGGTGAACTCGAGTTCACCTAATTCCATCTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014983    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_014223.2-1647s1c1
Sequence:CCGGCCTCAGATGGAATTAGGTGAACTCGAGTTCACCTAATTCCATCTGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014984    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_014223.2-997s1c1
Sequence:CCGGCCACCAATGCTCAACAGATTACTCGAGTAATCTGTTGAGCATTGGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014987    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_014223.2-318s1c1
Sequence:CCGGCTGGCTCGTATTAAGAAGATTCTCGAGAATCTTCTTAATACGAGCCAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014986    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_014223.2-872s1c1
Sequence:CCGGCATCACTAACACAGGAGAGATCTCGAGATCTCTCCTGTGTTAGTGATGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014985    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_014223.2-435s1c1
Sequence:CCGGGCCTGGATTCACACAGAAGATCTCGAGATCTTCTGTGTGAATCCAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014223
VALIDATED
NFYC MISSION shRNA shRNA Plasmid DNA
nuclear transcription factor Y, gamma
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000274071    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014223.4-723s21c1
Sequence:CCGGCGAGCCAGTCCAGTACTATTTCTCGAGAAATAGTACTGGACTGGCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274072    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_014223.4-556s21c1
Sequence:CCGGGCCTGGATTCACACAGAAGATCTCGAGATCTTCTGTGTGAATCCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274070    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_014223.4-602s21c1
Sequence:CCGGATGATATCGCCATGGCAATTACTCGAGTAATTGCCATGGCGATATCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274131    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_014223.4-386s21c1
Sequence:CCGGTGGAAGAAATCCGGAATTTAACTCGAGTTAAATTCCGGATTTCTTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274069    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_014223.4-1768s21c1
Sequence:CCGGCCTCAGATGGAATTAGGTGAACTCGAGTTCACCTAATTCCATCTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014983    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_014223.2-1647s1c1
Sequence:CCGGCCTCAGATGGAATTAGGTGAACTCGAGTTCACCTAATTCCATCTGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014984    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_014223.2-997s1c1
Sequence:CCGGCCACCAATGCTCAACAGATTACTCGAGTAATCTGTTGAGCATTGGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014987    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_014223.2-318s1c1
Sequence:CCGGCTGGCTCGTATTAAGAAGATTCTCGAGAATCTTCTTAATACGAGCCAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014986    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_014223.2-872s1c1
Sequence:CCGGCATCACTAACACAGGAGAGATCTCGAGATCTCTCCTGTGTTAGTGATGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014985    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_014223.2-435s1c1
Sequence:CCGGGCCTGGATTCACACAGAAGATCTCGAGATCTTCTGTGTGAATCCAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014223
VALIDATED
NFYC MISSION shRNA Lentiviral Transduction Particles
nuclear transcription factor Y, gamma
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000274071    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014223.4-723s21c1
Sequence:CCGGCGAGCCAGTCCAGTACTATTTCTCGAGAAATAGTACTGGACTGGCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274072    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_014223.4-556s21c1
Sequence:CCGGGCCTGGATTCACACAGAAGATCTCGAGATCTTCTGTGTGAATCCAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274070    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_014223.4-602s21c1
Sequence:CCGGATGATATCGCCATGGCAATTACTCGAGTAATTGCCATGGCGATATCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274131    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_014223.4-386s21c1
Sequence:CCGGTGGAAGAAATCCGGAATTTAACTCGAGTTAAATTCCGGATTTCTTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274069    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_014223.4-1768s21c1
Sequence:CCGGCCTCAGATGGAATTAGGTGAACTCGAGTTCACCTAATTCCATCTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014983    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_014223.2-1647s1c1
Sequence:CCGGCCTCAGATGGAATTAGGTGAACTCGAGTTCACCTAATTCCATCTGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014984    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_014223.2-997s1c1
Sequence:CCGGCCACCAATGCTCAACAGATTACTCGAGTAATCTGTTGAGCATTGGTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014987    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_014223.2-318s1c1
Sequence:CCGGCTGGCTCGTATTAAGAAGATTCTCGAGAATCTTCTTAATACGAGCCAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014986    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_014223.2-872s1c1
Sequence:CCGGCATCACTAACACAGGAGAGATCTCGAGATCTCTCCTGTGTTAGTGATGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014985    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_014223.2-435s1c1
Sequence:CCGGGCCTGGATTCACACAGAAGATCTCGAGATCTTCTGTGTGAATCCAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)