EMAIL THIS PAGE TO A FRIEND

NGB

neuroglobin

45 Gene Product Result for
UniProtKB ID: Q9NPG2
Gene ID:
Human(58157) Summary: This gene encodes an oxygen-binding protein that is distantly related to members of the globin gene family. It is highly conserved among other vertebrates. It is expressed in the central and peripheral nervous system where it may be involved in increasing oxygen availability and providing protection under hypoxic/ischemic conditions. [provided by RefSeq, Jul 2008]
Mouse(64242) neuroglobin
Rat(85382) neuroglobin
Zebrafish(100000711) neuroglobin
dog(442944) neuroglobin
cow(414920) neuroglobin
chicken(428896) neuroglobin
sheep(101113679) neuroglobin
sheep(443260) neuroglobin
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021257 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021257 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021257 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_022414 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_022414 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_022414 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021257 Rosetta Predictions human pricing
NM_033359 Rosetta Predictions rat pricing
NM_022414 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021257 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00230532 predicted 863
2 SASI_Hs01_00230533 predicted 702
3 SASI_Hs01_00230534 predicted 1323
4 SASI_Hs01_00230535 predicted 1125
5 SASI_Hs01_00230536 predicted 864
6 SASI_Hs01_00230537 predicted 567
7 SASI_Hs01_00230538 predicted 1044
8 SASI_Hs01_00230540 predicted 1179
9 SASI_Hs01_00230541 predicted 554
10 SASI_Hs02_00354917 predicted 1311
11 SASI_Hs01_00230539 predicted 395
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033359 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00115887 predicted 534
2 SASI_Rn01_00115888 predicted 933
3 SASI_Rn01_00115889 predicted 507
4 SASI_Rn01_00115890 predicted 768
5 SASI_Rn01_00115891 predicted 401
6 SASI_Rn01_00115892 predicted 435
7 SASI_Rn02_00265549 predicted 403
8 SASI_Rn01_00115895 predicted 573
9 SASI_Rn01_00115896 predicted 386
10 SASI_Rn02_00265550 predicted 1069
11 SASI_Rn01_00115893 predicted 686
12 SASI_Rn01_00115894 predicted 1035
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022414 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00102925 predicted 1223
2 SASI_Mm01_00102926 predicted 1053
3 SASI_Mm01_00102927 predicted 571
4 SASI_Mm01_00102928 predicted 1096
5 SASI_Mm01_00102929 predicted 537
6 SASI_Mm01_00102930 predicted 647
7 SASI_Mm01_00102931 predicted 677
8 SASI_Mm01_00102932 predicted 476
9 SASI_Mm01_00102933 predicted 1098
10 SASI_Mm02_00326591 predicted 451
11 SASI_Mm01_00102934 predicted 1135
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021257
NGB MISSION shRNA Bacterial Glycerol Stock
neuroglobin
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000440591    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021257.3-867s21c1
Sequence:CCGGGTCTGTCTGTTGGCCTGTATCCTCGAGGATACAGGCCAACAGACAGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059493    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021257.2-501s1c1
Sequence:CCGGCCAGTACAACTGCCGCCAGTTCTCGAGAACTGGCGGCAGTTGTACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021257.2-537s1c1
Sequence:CCGGCTGTCTCTCCTCGCCTGAGTTCTCGAGAACTCAGGCGAGGAGAGACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021257.2-681s1c1
Sequence:CCGGGCTCAGCTCCTTCTCGACAGTCTCGAGACTGTCGAGAAGGAGCTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021257.2-699s1c1
Sequence:CCGGAGTGGGTGAGTCTCTGCTCTACTCGAGTAGAGCAGAGACTCACCCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059495    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021257.2-577s1c1
Sequence:CCGGGTGATGCTCGTGATTGATGCTCTCGAGAGCATCAATCACGAGCATCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000439311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021257.3-605s21c1
Sequence:CCGGCCAATGTGGAAGACCTGTCCTCTCGAGAGGACAGGTCTTCCACATTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021257
NGB MISSION shRNA shRNA Plasmid DNA
neuroglobin
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000440591    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021257.3-867s21c1
Sequence:CCGGGTCTGTCTGTTGGCCTGTATCCTCGAGGATACAGGCCAACAGACAGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059493    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021257.2-501s1c1
Sequence:CCGGCCAGTACAACTGCCGCCAGTTCTCGAGAACTGGCGGCAGTTGTACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021257.2-537s1c1
Sequence:CCGGCTGTCTCTCCTCGCCTGAGTTCTCGAGAACTCAGGCGAGGAGAGACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021257.2-681s1c1
Sequence:CCGGGCTCAGCTCCTTCTCGACAGTCTCGAGACTGTCGAGAAGGAGCTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021257.2-699s1c1
Sequence:CCGGAGTGGGTGAGTCTCTGCTCTACTCGAGTAGAGCAGAGACTCACCCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059495    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021257.2-577s1c1
Sequence:CCGGGTGATGCTCGTGATTGATGCTCTCGAGAGCATCAATCACGAGCATCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000439311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021257.3-605s21c1
Sequence:CCGGCCAATGTGGAAGACCTGTCCTCTCGAGAGGACAGGTCTTCCACATTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021257
NGB MISSION shRNA Lentiviral Transduction Particles
neuroglobin
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000440591    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021257.3-867s21c1
Sequence:CCGGGTCTGTCTGTTGGCCTGTATCCTCGAGGATACAGGCCAACAGACAGACTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000059493    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021257.2-501s1c1
Sequence:CCGGCCAGTACAACTGCCGCCAGTTCTCGAGAACTGGCGGCAGTTGTACTGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000059497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021257.2-537s1c1
Sequence:CCGGCTGTCTCTCCTCGCCTGAGTTCTCGAGAACTCAGGCGAGGAGAGACAGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000059496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021257.2-681s1c1
Sequence:CCGGGCTCAGCTCCTTCTCGACAGTCTCGAGACTGTCGAGAAGGAGCTGAGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000059494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021257.2-699s1c1
Sequence:CCGGAGTGGGTGAGTCTCTGCTCTACTCGAGTAGAGCAGAGACTCACCCACTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000059495    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021257.2-577s1c1
Sequence:CCGGGTGATGCTCGTGATTGATGCTCTCGAGAGCATCAATCACGAGCATCACTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000439311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021257.3-605s21c1
Sequence:CCGGCCAATGTGGAAGACCTGTCCTCTCGAGAGGACAGGTCTTCCACATTGGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022414
NGB MISSION shRNA Bacterial Glycerol Stock
neuroglobin
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000120917    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022414.2-1095s1c1
Sequence:CCGGGCCAAGCTGTTTACTTTCCAACTCGAGTTGGAAAGTAAACAGCTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120920    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022414.2-522s1c1
Sequence:CCGGCCTGTCTTCATTGGAGGAGTACTCGAGTACTCCTCCAATGAAGACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022414.2-393s1c1
Sequence:CCGGGCTGCCTCTCTTCCAGTACAACTCGAGTTGTACTGGAAGAGAGGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022414.2-647s1c1
Sequence:CCGGCCGACTTTACACCAGCTACAACTCGAGTTGTAGCTGGTGTAAAGTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022414.2-364s1c1
Sequence:CCGGGCCAGGCTCTTCGCCCTGGAACTCGAGTTCCAGGGCGAAGAGCCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022414
NGB MISSION shRNA shRNA Plasmid DNA
neuroglobin
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000120917    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022414.2-1095s1c1
Sequence:CCGGGCCAAGCTGTTTACTTTCCAACTCGAGTTGGAAAGTAAACAGCTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120920    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022414.2-522s1c1
Sequence:CCGGCCTGTCTTCATTGGAGGAGTACTCGAGTACTCCTCCAATGAAGACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022414.2-393s1c1
Sequence:CCGGGCTGCCTCTCTTCCAGTACAACTCGAGTTGTACTGGAAGAGAGGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022414.2-647s1c1
Sequence:CCGGCCGACTTTACACCAGCTACAACTCGAGTTGTAGCTGGTGTAAAGTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022414.2-364s1c1
Sequence:CCGGGCCAGGCTCTTCGCCCTGGAACTCGAGTTCCAGGGCGAAGAGCCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022414
NGB MISSION shRNA Lentiviral Transduction Particles
neuroglobin
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000120917    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022414.2-1095s1c1
Sequence:CCGGGCCAAGCTGTTTACTTTCCAACTCGAGTTGGAAAGTAAACAGCTTGGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000120920    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022414.2-522s1c1
Sequence:CCGGCCTGTCTTCATTGGAGGAGTACTCGAGTACTCCTCCAATGAAGACAGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000120919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022414.2-393s1c1
Sequence:CCGGGCTGCCTCTCTTCCAGTACAACTCGAGTTGTACTGGAAGAGAGGCAGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000120918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022414.2-647s1c1
Sequence:CCGGCCGACTTTACACCAGCTACAACTCGAGTTGTAGCTGGTGTAAAGTCGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000120921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022414.2-364s1c1
Sequence:CCGGGCCAGGCTCTTCGCCCTGGAACTCGAGTTCCAGGGCGAAGAGCCTGGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???