EMAIL THIS PAGE TO A FRIEND

NGEF

neuronal guanine nucleotide exchange factor

92 Gene Product Result for
Synonyms: ARHGEF27 EPHEXIN
Gene ID:
Mouse(53972) neuronal guanine nucleotide exchange factor
Rat(246217) neuronal guanine nucleotide exchange factor
chicken(424744) neuronal guanine nucleotide exchange factor
cow(540756) neuronal guanine nucleotide exchange factor
Horse(100057337) neuronal guanine nucleotide exchange factor
domestic cat(101100242) neuronal guanine nucleotide exchange factor
dog(486165) neuronal guanine nucleotide exchange factor
sheep(101113454) neuronal guanine nucleotide exchange factor
domestic guinea pig(100723288) neuronal guanine nucleotide exchange factor
naked mole-rat(101711158) neuronal guanine nucleotide exchange factor
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019867 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019867 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019867 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_019850 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_019850 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_019850 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001114090 Rosetta Predictions human pricing
NM_019850 Rosetta Predictions human pricing
XM_001066859 Rosetta Predictions rat pricing
XM_346854 Rosetta Predictions rat pricing
NM_001111314 Rosetta Predictions mouse pricing
NM_019867 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001114090 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00326164 predicted 916
2 SASI_Hs02_00326165 predicted 1675
3 SASI_Hs02_00326166 predicted 1233
4 SASI_Hs02_00326167 predicted 2375
5 SASI_Hs02_00326168 predicted 2338
6 SASI_Hs02_00326169 predicted 1470
7 SASI_Hs02_00326170 predicted 1094
8 SASI_Hs02_00326171 predicted 1628
9 SASI_Hs02_00326172 predicted 2378
10 SASI_Hs02_00326173 predicted 952
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019850 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00352861 predicted 1287
2 SASI_Hs02_00352862 predicted 2046
3 SASI_Hs02_00352863 predicted 1601
4 SASI_Hs02_00352864 predicted 2752
5 SASI_Hs02_00352865 predicted 2703
6 SASI_Hs02_00352866 predicted 1843
7 SASI_Hs02_00352867 predicted 1466
8 SASI_Hs02_00352868 predicted 2001
9 SASI_Hs02_00352869 predicted 2754
10 SASI_Hs01_00130147 predicted 1328
11 SASI_Hs01_00130141 predicted 1837
12 SASI_Hs01_00130142 predicted 301
13 SASI_Hs01_00130143 predicted 411
14 SASI_Hs01_00130144 predicted 1763
15 SASI_Hs01_00130145 predicted 1286
16 SASI_Hs01_00130146 predicted 284
17 SASI_Hs01_00130148 predicted 1776
18 SASI_Hs01_00130149 predicted 2039
19 SASI_Hs01_00130150 predicted 279
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001066859 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00318919 predicted 1056
2 SASI_Rn02_00318920 predicted 1718
3 SASI_Rn02_00318921 predicted 880
4 SASI_Rn02_00318922 predicted 856
5 SASI_Rn02_00318923 predicted 1349
6 SASI_Rn02_00318924 predicted 893
7 SASI_Rn02_00318925 predicted 1621
8 SASI_Rn02_00318926 predicted 872
9 SASI_Rn02_00318927 predicted 1404
10 SASI_Rn02_00318928 predicted 937
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_346854 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00399394 predicted 1468
2 SASI_Rn02_00399395 predicted 1292
3 SASI_Rn02_00399396 predicted 1266
4 SASI_Rn02_00399397 predicted 464
5 SASI_Rn02_00399398 predicted 507
6 SASI_Rn02_00399399 predicted 497
7 SASI_Rn02_00399400 predicted 1301
8 SASI_Rn02_00399401 predicted 2031
9 SASI_Rn02_00399402 predicted 1280
10 SASI_Rn02_00399403 predicted 1816
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001111314 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00306776 predicted 2012
2 SASI_Mm02_00306777 predicted 1325
3 SASI_Mm02_00306778 predicted 2298
4 SASI_Mm02_00306779 predicted 1921
5 SASI_Mm02_00306780 predicted 2460
6 SASI_Mm02_00306781 predicted 2298
7 SASI_Mm02_00306782 predicted 1924
8 SASI_Mm02_00306783 predicted 1328
9 SASI_Mm02_00306784 predicted 1591
10 SASI_Mm02_00306785 predicted 1648
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019867 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00182107 predicted 1650
2 SASI_Mm01_00182108 predicted 953
3 SASI_Mm01_00182109 predicted 1929
4 SASI_Mm01_00182110 predicted 1556
5 SASI_Mm01_00182111 predicted 2096
6 SASI_Mm01_00182112 predicted 1932
7 SASI_Mm01_00182113 predicted 1559
8 SASI_Mm01_00182114 predicted 961
9 SASI_Mm01_00182115 predicted 1230
10 SASI_Mm01_00182116 predicted 1279
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019867
VALIDATED
NGEF MISSION shRNA Bacterial Glycerol Stock
neuronal guanine nucleotide exchange factor
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000193333    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_019867.1-2217s1c1
Sequence:CCGGCTAAGTACTTAGGCAGTATTACTCGAGTAATACTGCCTAAGTACTTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176123    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019867.1-385s1c1
Sequence:CCGGGAACAAATAGGGCTCCTGTATCTCGAGATACAGGAGCCCTATTTGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174393    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_019867.1-960s1c1
Sequence:CCGGCTATATCACTTACGTCAGTAACTCGAGTTACTGACGTAAGTGATATAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215945    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_019867.2-907s1c1
Sequence:CCGGCATGGAGGAGAACATTGTTATCTCGAGATAACAATGTTCTCCTCCATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240856    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019867.2-2396s21c1
Sequence:CCGGCACGTGTCCTTCCCTACTTTGCTCGAGCAAAGTAGGGAAGGACACGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240855    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019867.2-1612s21c1
Sequence:CCGGTGACCGAGAGGCCACCTATATCTCGAGATATAGGTGGCCTCTCGGTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240854    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019867.2-1939s21c1
Sequence:CCGGGGAATGTTTCCGGGTACATAACTCGAGTTATGTACCCGGAAACATTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257122    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019867.2-1786s21c1
Sequence:CCGGGACGCTGGAACTGGCAGATATCTCGAGATATCTGCCAGTTCCAGCGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257135    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019867.2-741s21c1
Sequence:CCGGCCTCTGAGGCCTCCTACTATACTCGAGTATAGTAGGAGGCCTCAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019867
VALIDATED
NGEF MISSION shRNA shRNA Plasmid DNA
neuronal guanine nucleotide exchange factor
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000193333    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_019867.1-2217s1c1
Sequence:CCGGCTAAGTACTTAGGCAGTATTACTCGAGTAATACTGCCTAAGTACTTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176123    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019867.1-385s1c1
Sequence:CCGGGAACAAATAGGGCTCCTGTATCTCGAGATACAGGAGCCCTATTTGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174393    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_019867.1-960s1c1
Sequence:CCGGCTATATCACTTACGTCAGTAACTCGAGTTACTGACGTAAGTGATATAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000215945    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_019867.2-907s1c1
Sequence:CCGGCATGGAGGAGAACATTGTTATCTCGAGATAACAATGTTCTCCTCCATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000240856    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019867.2-2396s21c1
Sequence:CCGGCACGTGTCCTTCCCTACTTTGCTCGAGCAAAGTAGGGAAGGACACGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000240855    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019867.2-1612s21c1
Sequence:CCGGTGACCGAGAGGCCACCTATATCTCGAGATATAGGTGGCCTCTCGGTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000240854    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019867.2-1939s21c1
Sequence:CCGGGGAATGTTTCCGGGTACATAACTCGAGTTATGTACCCGGAAACATTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257122    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019867.2-1786s21c1
Sequence:CCGGGACGCTGGAACTGGCAGATATCTCGAGATATCTGCCAGTTCCAGCGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257135    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019867.2-741s21c1
Sequence:CCGGCCTCTGAGGCCTCCTACTATACTCGAGTATAGTAGGAGGCCTCAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019867
VALIDATED
NGEF MISSION shRNA Lentiviral Transduction Particles
neuronal guanine nucleotide exchange factor
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000193333    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_019867.1-2217s1c1
Sequence:CCGGCTAAGTACTTAGGCAGTATTACTCGAGTAATACTGCCTAAGTACTTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176123    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019867.1-385s1c1
Sequence:CCGGGAACAAATAGGGCTCCTGTATCTCGAGATACAGGAGCCCTATTTGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174393    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_019867.1-960s1c1
Sequence:CCGGCTATATCACTTACGTCAGTAACTCGAGTTACTGACGTAAGTGATATAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215945    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_019867.2-907s1c1
Sequence:CCGGCATGGAGGAGAACATTGTTATCTCGAGATAACAATGTTCTCCTCCATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240856    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019867.2-2396s21c1
Sequence:CCGGCACGTGTCCTTCCCTACTTTGCTCGAGCAAAGTAGGGAAGGACACGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240855    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019867.2-1612s21c1
Sequence:CCGGTGACCGAGAGGCCACCTATATCTCGAGATATAGGTGGCCTCTCGGTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000240854    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019867.2-1939s21c1
Sequence:CCGGGGAATGTTTCCGGGTACATAACTCGAGTTATGTACCCGGAAACATTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257122    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019867.2-1786s21c1
Sequence:CCGGGACGCTGGAACTGGCAGATATCTCGAGATATCTGCCAGTTCCAGCGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257135    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019867.2-741s21c1
Sequence:CCGGCCTCTGAGGCCTCCTACTATACTCGAGTATAGTAGGAGGCCTCAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019850
NGEF MISSION shRNA Bacterial Glycerol Stock
neuronal guanine nucleotide exchange factor
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000047654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019850.1-406s1c1
Sequence:CCGGCCCAATTAAGAGAAATTCCATCTCGAGATGGAATTTCTCTTAATTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019850.1-2269s1c1
Sequence:CCGGCCAGAACCTCAAGGAATGTTTCTCGAGAAACATTCCTTGAGGTTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019850.1-1834s1c1
Sequence:CCGGAGGAGACAAGTACCAGGTATTCTCGAGAATACCTGGTACTTGTCTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019850.1-782s1c1
Sequence:CCGGCGAGATAAATCGACTCTCCAACTCGAGTTGGAGAGTCGATTTATCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431839    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019850.2-2554s21c1
Sequence:CCGGTTGCTCGCAAACTGGATAAAGCTCGAGCTTTATCCAGTTTGCGAGCAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419699    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019850.2-304s21c1
Sequence:CCGGATCAATGGAACACTGATAATGCTCGAGCATTATCAGTGTTCCATTGATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419681    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019850.2-1781s21c1
Sequence:CCGGGAAGCTCTTCCACGAAATTTACTCGAGTAAATTTCGTGGAAGAGCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019850
NGEF MISSION shRNA shRNA Plasmid DNA
neuronal guanine nucleotide exchange factor
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000047654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019850.1-406s1c1
Sequence:CCGGCCCAATTAAGAGAAATTCCATCTCGAGATGGAATTTCTCTTAATTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019850.1-2269s1c1
Sequence:CCGGCCAGAACCTCAAGGAATGTTTCTCGAGAAACATTCCTTGAGGTTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019850.1-1834s1c1
Sequence:CCGGAGGAGACAAGTACCAGGTATTCTCGAGAATACCTGGTACTTGTCTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019850.1-782s1c1
Sequence:CCGGCGAGATAAATCGACTCTCCAACTCGAGTTGGAGAGTCGATTTATCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431839    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019850.2-2554s21c1
Sequence:CCGGTTGCTCGCAAACTGGATAAAGCTCGAGCTTTATCCAGTTTGCGAGCAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419699    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019850.2-304s21c1
Sequence:CCGGATCAATGGAACACTGATAATGCTCGAGCATTATCAGTGTTCCATTGATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419681    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019850.2-1781s21c1
Sequence:CCGGGAAGCTCTTCCACGAAATTTACTCGAGTAAATTTCGTGGAAGAGCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019850
NGEF MISSION shRNA Lentiviral Transduction Particles
neuronal guanine nucleotide exchange factor
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000047654    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019850.1-406s1c1
Sequence:CCGGCCCAATTAAGAGAAATTCCATCTCGAGATGGAATTTCTCTTAATTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019850.1-2269s1c1
Sequence:CCGGCCAGAACCTCAAGGAATGTTTCTCGAGAAACATTCCTTGAGGTTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019850.1-1834s1c1
Sequence:CCGGAGGAGACAAGTACCAGGTATTCTCGAGAATACCTGGTACTTGTCTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019850.1-782s1c1
Sequence:CCGGCGAGATAAATCGACTCTCCAACTCGAGTTGGAGAGTCGATTTATCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431839    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019850.2-2554s21c1
Sequence:CCGGTTGCTCGCAAACTGGATAAAGCTCGAGCTTTATCCAGTTTGCGAGCAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419699    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019850.2-304s21c1
Sequence:CCGGATCAATGGAACACTGATAATGCTCGAGCATTATCAGTGTTCCATTGATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419681    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019850.2-1781s21c1
Sequence:CCGGGAAGCTCTTCCACGAAATTTACTCGAGTAAATTTCGTGGAAGAGCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)