EMAIL THIS PAGE TO A FRIEND

NGF

nerve growth factor (beta polypeptide)

99 Gene Product Result for
Synonyms: Beta-NGF HSAN5 NGFB
UniProtKB ID: P01138, A1A4E5, Q6FHA0, Q96P60, Q9P2Q8, Q9UKL8
Gene ID:
Human(4803) Summary: This gene is a member of the NGF-beta family and encodes a secreted protein which homodimerizes and is incorporated into a larger complex. This protein has nerve growth stimulating activity and the complex is involved in the regulation of growth and the differentiation of sympathetic and certain sensory neurons. Mutations in this gene have been associated with hereditary sensory and autonomic neuropathy, type 5 (HSAN5), and dysregulation of this gene's expression is associated with allergic rhinitis. [provided by RefSeq, Jul 2008]
Mouse(18049) nerve growth factor
Rat(310738) nerve growth factor (beta polypeptide)
naked mole-rat(101722226) nerve growth factor (beta polypeptide)
domestic guinea pig(100733367) nerve growth factor (beta polypeptide)
Goat(100862660) nerve growth factor (beta polypeptide)
sheep(101104540) nerve growth factor (beta polypeptide)
Zebrafish(58133) nerve growth factor (beta polypeptide)
chicken(396466) nerve growth factor (beta polypeptide)
dog(403402) nerve growth factor (beta polypeptide)
cow(281350) nerve growth factor (beta polypeptide)
domestic cat(100144611) nerve growth factor (beta polypeptide)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002506 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002506 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002506 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_013609 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013609 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013609 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002506 Rosetta Predictions human pricing
XM_001067130 Rosetta Predictions rat pricing
XM_227525 Rosetta Predictions rat pricing
NM_001112698 Rosetta Predictions mouse pricing
NM_013609 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002506 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00333968 predicted 556
2 SASI_Hs02_00333969 predicted 221
3 SASI_Hs02_00333970 predicted 520
4 SASI_Hs01_00162776 predicted 553
5 SASI_Hs01_00162778 predicted 747
6 SASI_Hs01_00162779 predicted 739
7 SASI_Hs01_00162780 predicted 702
8 SASI_Hs01_00162781 predicted 455
9 SASI_Hs01_00162783 predicted 820
10 SASI_Hs02_00333971 predicted 236
11 SASI_Hs01_00162777 predicted 628
12 SASI_Hs01_00162782 predicted 694
13 SASI_Hs01_00162784 predicted 775
14 SASI_Hs01_00162785 predicted 764
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001067130 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00319948 predicted 1698
2 SASI_Rn02_00319949 predicted 1004
3 SASI_Rn02_00319950 predicted 1190
4 SASI_Rn02_00319951 predicted 964
5 SASI_Rn02_00319952 predicted 982
6 SASI_Rn02_00319953 predicted 1262
7 SASI_Rn02_00319954 predicted 1825
8 SASI_Rn02_00319955 predicted 1195
9 SASI_Rn02_00319956 predicted 1812
10 SASI_Rn02_00319957 predicted 928
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_227525 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00384451 predicted 242
2 SASI_Rn02_00384452 predicted 284
3 SASI_Rn02_00384453 predicted 287
4 SASI_Rn02_00384454 predicted 250
5 SASI_Rn02_00384455 predicted 291
6 SASI_Rn02_00384456 predicted 241
7 SASI_Rn02_00384457 predicted 351
8 SASI_Rn02_00384458 predicted 203
9 SASI_Rn02_00384459 predicted 297
10 SASI_Rn02_00384460 predicted 226
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001112698 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00306903 predicted 582
2 SASI_Mm02_00306904 predicted 225
3 SASI_Mm02_00306905 predicted 745
4 SASI_Mm02_00306906 predicted 572
5 SASI_Mm02_00306907 predicted 487
6 SASI_Mm02_00306908 predicted 791
7 SASI_Mm02_00306909 predicted 331
8 SASI_Mm02_00306910 predicted 827
9 SASI_Mm02_00306911 predicted 702
10 SASI_Mm02_00306912 predicted 782
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013609 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00088833 predicted 268
2 SASI_Mm01_00088834 predicted 214
3 SASI_Mm01_00088835 predicted 357
4 SASI_Mm01_00088836 predicted 338
5 SASI_Mm01_00088837 predicted 876
6 SASI_Mm01_00088838 predicted 241
7 SASI_Mm01_00088839 predicted 287
8 SASI_Mm01_00088840 predicted 697
9 SASI_Mm01_00088841 predicted 921
10 SASI_Mm01_00088842 predicted 291
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002506
VALIDATED
NGF MISSION shRNA Bacterial Glycerol Stock
nerve growth factor (beta polypeptide)
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000442190    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002506.2-604s21c1
Sequence:CCGGTAAGACCACCGCCACAGACATCTCGAGATGTCTGTGGCGGTGGTCTTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419305    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002506.2-753s21c1
Sequence:CCGGAGCACTGGAACTCATATTGTACTCGAGTACAATATGAGTTCCAGTGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437161    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002506.2-460s21c1
Sequence:CCGGTGCAGACACTCAGGATCTGGACTCGAGTCCAGATCCTGAGTGTCTGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438167    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002506.2-365s21c1
Sequence:CCGGCAGACCCGCAACATTACTGTGCTCGAGCACAGTAATGTTGCGGGTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432713    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002506.2-645s21c1
Sequence:CCGGTGTTGGGAGAGGTGAACATTACTCGAGTAATGTTCACCTCTCCCAACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437913    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002506.2-227s21c1
Sequence:CCGGCCACACTCAGAGAGCAATGTCCTCGAGGACATTGCTCTCTGAGTGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058403    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002506.1-667s1c1
Sequence:CCGGCAACAGTGTATTCAAACAGTACTCGAGTACTGTTTGAATACACTGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058404    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002506.1-276s1c1
Sequence:CCGGACTGGACTAAACTTCAGCATTCTCGAGAATGCTGAAGTTTAGTCCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058407    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002506.1-775s1c1
Sequence:CCGGCACGACTCACACCTTTGTCAACTCGAGTTGACAAAGGTGTGAGTCGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058406    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002506.1-529s1c1
Sequence:CCGGGCGGTCATCATCCCATCCCATCTCGAGATGGGATGGGATGATGACCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058405    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002506.1-827s1c1
Sequence:CCGGTGGCGGTTTATCCGGATAGATCTCGAGATCTATCCGGATAAACCGCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002506
VALIDATED
NGF MISSION shRNA shRNA Plasmid DNA
nerve growth factor (beta polypeptide)
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000442190    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002506.2-604s21c1
Sequence:CCGGTAAGACCACCGCCACAGACATCTCGAGATGTCTGTGGCGGTGGTCTTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419305    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002506.2-753s21c1
Sequence:CCGGAGCACTGGAACTCATATTGTACTCGAGTACAATATGAGTTCCAGTGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437161    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002506.2-460s21c1
Sequence:CCGGTGCAGACACTCAGGATCTGGACTCGAGTCCAGATCCTGAGTGTCTGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000438167    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002506.2-365s21c1
Sequence:CCGGCAGACCCGCAACATTACTGTGCTCGAGCACAGTAATGTTGCGGGTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432713    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002506.2-645s21c1
Sequence:CCGGTGTTGGGAGAGGTGAACATTACTCGAGTAATGTTCACCTCTCCCAACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437913    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002506.2-227s21c1
Sequence:CCGGCCACACTCAGAGAGCAATGTCCTCGAGGACATTGCTCTCTGAGTGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058403    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002506.1-667s1c1
Sequence:CCGGCAACAGTGTATTCAAACAGTACTCGAGTACTGTTTGAATACACTGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058404    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002506.1-276s1c1
Sequence:CCGGACTGGACTAAACTTCAGCATTCTCGAGAATGCTGAAGTTTAGTCCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058407    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002506.1-775s1c1
Sequence:CCGGCACGACTCACACCTTTGTCAACTCGAGTTGACAAAGGTGTGAGTCGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058406    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002506.1-529s1c1
Sequence:CCGGGCGGTCATCATCCCATCCCATCTCGAGATGGGATGGGATGATGACCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058405    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002506.1-827s1c1
Sequence:CCGGTGGCGGTTTATCCGGATAGATCTCGAGATCTATCCGGATAAACCGCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002506
VALIDATED
NGF MISSION shRNA Lentiviral Transduction Particles
nerve growth factor (beta polypeptide)
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000442190    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002506.2-604s21c1
Sequence:CCGGTAAGACCACCGCCACAGACATCTCGAGATGTCTGTGGCGGTGGTCTTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419305    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002506.2-753s21c1
Sequence:CCGGAGCACTGGAACTCATATTGTACTCGAGTACAATATGAGTTCCAGTGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437161    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002506.2-460s21c1
Sequence:CCGGTGCAGACACTCAGGATCTGGACTCGAGTCCAGATCCTGAGTGTCTGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438167    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002506.2-365s21c1
Sequence:CCGGCAGACCCGCAACATTACTGTGCTCGAGCACAGTAATGTTGCGGGTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432713    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002506.2-645s21c1
Sequence:CCGGTGTTGGGAGAGGTGAACATTACTCGAGTAATGTTCACCTCTCCCAACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437913    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002506.2-227s21c1
Sequence:CCGGCCACACTCAGAGAGCAATGTCCTCGAGGACATTGCTCTCTGAGTGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058403    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002506.1-667s1c1
Sequence:CCGGCAACAGTGTATTCAAACAGTACTCGAGTACTGTTTGAATACACTGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058404    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002506.1-276s1c1
Sequence:CCGGACTGGACTAAACTTCAGCATTCTCGAGAATGCTGAAGTTTAGTCCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058407    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002506.1-775s1c1
Sequence:CCGGCACGACTCACACCTTTGTCAACTCGAGTTGACAAAGGTGTGAGTCGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058406    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002506.1-529s1c1
Sequence:CCGGGCGGTCATCATCCCATCCCATCTCGAGATGGGATGGGATGATGACCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058405    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_002506.1-827s1c1
Sequence:CCGGTGGCGGTTTATCCGGATAGATCTCGAGATCTATCCGGATAAACCGCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013609
VALIDATED
NGF MISSION shRNA Bacterial Glycerol Stock
nerve growth factor (beta polypeptide)
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000379142    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013609.2-351s21c1
Sequence:CCGGGAACCGTACACAGATAGCAATCTCGAGATTGCTATCTGTGTACGGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375353    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013609.2-713s21c1
Sequence:CCGGCAGTGTGTGGGTTGGAGATAACTCGAGTTATCTCCAACCCACACACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013609.2-222s21c1
Sequence:CCGGTCAGTGTCTGGGCCCAATAAACTCGAGTTTATTGGGCCCAGACACTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339242    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013609.2-250s21c1
Sequence:CCGGCCAAGGACGCAGCTTTCTATACTCGAGTATAGAAAGCTGCGTCCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339314    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013609.2-279s21c1
Sequence:CCGGAGTGAGGTGCATAGCGTAATGCTCGAGCATTACGCTATGCACCTCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000351084    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_013609.2-393s21c1
Sequence:CCGGCCTGAAGCCCACTGGACTAAACTCGAGTTTAGTCCAGTGGGCTTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068128    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013609.1-289s1c1
Sequence:CCGGGCATAGCGTAATGTCCATGTTCTCGAGAACATGGACATTACGCTATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013609.1-877s1c1
Sequence:CCGGCTCCAAACACTGGAACTCATACTCGAGTATGAGTTCCAGTGTTTGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068132    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013609.1-799s1c1
Sequence:CCGGCAGTGTATTCAGACAGTACTTCTCGAGAAGTACTGTCTGAATACACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013609.1-519s1c1
Sequence:CCGGCCAGACTGTTTAAGAAACGGACTCGAGTCCGTTTCTTAAACAGTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013609.1-404s1c1
Sequence:CCGGCACTGGACTAAACTTCAGCATCTCGAGATGCTGAAGTTTAGTCCAGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013609
VALIDATED
NGF MISSION shRNA shRNA Plasmid DNA
nerve growth factor (beta polypeptide)
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000379142    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013609.2-351s21c1
Sequence:CCGGGAACCGTACACAGATAGCAATCTCGAGATTGCTATCTGTGTACGGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000375353    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013609.2-713s21c1
Sequence:CCGGCAGTGTGTGGGTTGGAGATAACTCGAGTTATCTCCAACCCACACACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000339243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013609.2-222s21c1
Sequence:CCGGTCAGTGTCTGGGCCCAATAAACTCGAGTTTATTGGGCCCAGACACTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000339242    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013609.2-250s21c1
Sequence:CCGGCCAAGGACGCAGCTTTCTATACTCGAGTATAGAAAGCTGCGTCCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000339314    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013609.2-279s21c1
Sequence:CCGGAGTGAGGTGCATAGCGTAATGCTCGAGCATTACGCTATGCACCTCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000351084    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_013609.2-393s21c1
Sequence:CCGGCCTGAAGCCCACTGGACTAAACTCGAGTTTAGTCCAGTGGGCTTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068128    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013609.1-289s1c1
Sequence:CCGGGCATAGCGTAATGTCCATGTTCTCGAGAACATGGACATTACGCTATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013609.1-877s1c1
Sequence:CCGGCTCCAAACACTGGAACTCATACTCGAGTATGAGTTCCAGTGTTTGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068132    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013609.1-799s1c1
Sequence:CCGGCAGTGTATTCAGACAGTACTTCTCGAGAAGTACTGTCTGAATACACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013609.1-519s1c1
Sequence:CCGGCCAGACTGTTTAAGAAACGGACTCGAGTCCGTTTCTTAAACAGTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000068130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013609.1-404s1c1
Sequence:CCGGCACTGGACTAAACTTCAGCATCTCGAGATGCTGAAGTTTAGTCCAGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013609
VALIDATED
NGF MISSION shRNA Lentiviral Transduction Particles
nerve growth factor (beta polypeptide)
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000379142    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013609.2-351s21c1
Sequence:CCGGGAACCGTACACAGATAGCAATCTCGAGATTGCTATCTGTGTACGGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375353    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013609.2-713s21c1
Sequence:CCGGCAGTGTGTGGGTTGGAGATAACTCGAGTTATCTCCAACCCACACACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013609.2-222s21c1
Sequence:CCGGTCAGTGTCTGGGCCCAATAAACTCGAGTTTATTGGGCCCAGACACTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339242    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013609.2-250s21c1
Sequence:CCGGCCAAGGACGCAGCTTTCTATACTCGAGTATAGAAAGCTGCGTCCTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339314    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013609.2-279s21c1
Sequence:CCGGAGTGAGGTGCATAGCGTAATGCTCGAGCATTACGCTATGCACCTCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000351084    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_013609.2-393s21c1
Sequence:CCGGCCTGAAGCCCACTGGACTAAACTCGAGTTTAGTCCAGTGGGCTTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068128    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013609.1-289s1c1
Sequence:CCGGGCATAGCGTAATGTCCATGTTCTCGAGAACATGGACATTACGCTATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013609.1-877s1c1
Sequence:CCGGCTCCAAACACTGGAACTCATACTCGAGTATGAGTTCCAGTGTTTGGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068132    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013609.1-799s1c1
Sequence:CCGGCAGTGTATTCAGACAGTACTTCTCGAGAAGTACTGTCTGAATACACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013609.1-519s1c1
Sequence:CCGGCCAGACTGTTTAAGAAACGGACTCGAGTCCGTTTCTTAAACAGTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000068130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013609.1-404s1c1
Sequence:CCGGCACTGGACTAAACTTCAGCATCTCGAGATGCTGAAGTTTAGTCCAGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)