EMAIL THIS PAGE TO A FRIEND

NGFR

nerve growth factor receptor

173 Gene Product Result for
Synonyms: CD271 Gp80-LNGFR TNFRSF16 p75(NTR) p75NTR
UniProtKB ID: P08138, B2R961
Gene ID:
Human(4804) Summary: Nerve growth factor receptor contains an extracellular domain containing four 40-amino acid repeats with 6 cysteine residues at conserved positions followed by a serine/threonine-rich region, a single transmembrane domain, and a 155-amino acid cytoplasmic domain. The cysteine-rich region contains the nerve growth factor binding domain. [provided by RefSeq, Jul 2008]
Mouse(18053) nerve growth factor receptor (TNFR superfamily, member 16)
Rat(24596) nerve growth factor receptor
sheep(101119064) nerve growth factor receptor
domestic guinea pig(100716626) nerve growth factor receptor
naked mole-rat(101724251) nerve growth factor receptor
chicken(425805) nerve growth factor receptor
domestic cat(101101519) nerve growth factor receptor
dog(491071) nerve growth factor receptor
cow(353110) nerve growth factor receptor
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1306228 ANTI-CD271(C-TERMINAL) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
immunohistochemistry, western blot pricing
N3908 Anti-Nerve Growth Factor Receptor (NGFR p75) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution rat
immunofluorescence, immunohistochemistry, microarray, western blot pricing
N5788 Anti-Nerve Growth Factor Receptor/TNFRSF16 antibody produced in goat affinity isolated antibody, lyophilized powder mouse
immunohistochemistry, western blot pricing
N6163 Anti-Nerve Growth Factor Receptor/TNFRSF16 antibody produced in goat affinity isolated antibody, lyophilized powder human
western blot pricing
SAB2500694 Anti-NGFR antibody produced in goat affinity isolated antibody, buffered aqueous solution human, canine, rat, mouse
ELISA, western blot pricing
SAB2502011 Anti-NGFR antibody produced in goat affinity isolated antibody, buffered aqueous solution bovine, pig, human, rat
ELISA, western blot pricing
HPA004765 Anti-NGFR antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
SAB3500298 Anti-NGFR antibody produced in rabbit affinity isolated antibody, buffered aqueous solution mouse, human
ELISA, immunocytochemistry, western blot pricing
P5498 Anti-Pro-NGF antibody produced in rabbit affinity isolated antibody, lyophilized powder human, rat, mouse
immunohistochemistry, western blot pricing
SAB4502004 Anti-TNR16 antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, immunofluorescence, western blot pricing
N5408 Monoclonal Anti-Nerve Growth Factor Receptor (NGFR p75) antibody produced in mouse clone ME20.4, ascites fluid human, racoon, pig, monkey, feline
ELISA, flow cytometry, immunohistochemistry, immunoprecipitation (IP), microarray, neutralization, radioimmunoassay, western blot pricing
SAB5300237 Monoclonal Anti-NGFR antibody produced in mouse clone 2F1C2, ascites fluid human
ELISA, flow cytometry, immunofluorescence, western blot pricing

Small Molecule - Antagonist

Product # Description Species Add to Cart
 
D138 5,7-Dichlorokynurenic acid monohydrate solid, ≥98% (HPLC) human, mouse, rat pricing
K3375 Kynurenic acid ≥98% human, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_033217 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_033217 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_033217 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002507 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002507 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002507 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU075691 MISSION® esiRNA esiRNA targeting mouse Ngfr (esiRNA1) mouse pricing

Related Products

Product # Description Species Add to Cart
 
MAB5592 Anti-Nerve Growth Factor Receptor Antibody, clone MLR2 Anti-Nerve Growth Factor Receptor Antibody, clone MLR2 detects level of Nerve Growth Factor Receptor & has been published & validated for use in IH. pricing
MAB365 Anti-Nerve Growth Factor Receptor Antibody, extracellular, clone 192-IgG Anti-Nerve Growth Factor Receptor Antibody, extracellular, clone 192-IgG is an antibody against Nerve Growth Factor Receptor for use in IC, IH, IP, FUNC & WB. pricing
AB1554 Anti-Nerve Growth Factor Receptor Antibody, p75 Anti-Nerve Growth Factor Receptor Antibody, p75 is an antibody against Nerve Growth Factor Receptor for use in IC, IH(P),WB and IP. pricing
MAB5386X Anti-Nerve Growth Factor Receptor Antibody, p75, Alexa Fluor® 488 This Anti-Nerve Growth Factor Receptor Antibody, p75, Alexa Fluor 488 is validated for use in FC, IC for the detection of Nerve Growth Factor Receptor. pricing
MAB5386 Anti-Nerve Growth Factor Receptor (p75) Antibody, clone ME20.4 Anti-Nerve Growth Factor Receptor (p75) Antibody, clone ME20.4 detects level of Nerve Growth Factor Receptor (p75) & has been published & validated for use in FC, IC, IH, IH(P), IP, RIA & WB. pricing
MAB390 Anti-p75 LNGFR Antibody, Saporin conjugated, clone 192 Anti-p75 Low Affinity Nerve Growth Factor Receptor Antibody, Saporin conjugated, clone 192 is an antibody against p75 Low Affinity Nerve Growth Factor Receptor for use in 0. pricing
MAB390-25UG Anti-p75 LNGFR Antibody, Saporin conjugated, clone 192 This Anti-p75 Low Affinity Nerve Growth Factor Receptor Antibody, Saporin conjugated, clone 192 is validated for use in ICC, IHC(P), FUNC for the detection of p75 Low Affinity Nerve Growth Factor Receptor. pricing
ABN1655 Anti-p75NTR Antibody, ICD Anti-p75NTR, ICD, Cat. No. ABN1655, is a highly specific rabbit polyclonal antiserum that targets up75NTR (neurotrophin receptor) and has been tested in Immunocytochemistry, Immunofluorescence, Immunoprecipitation, and Western Blotting. pricing
07-476 Anti-p75NTR (Neurotrophin Receptor) Antibody Detect p75NTR (Neurotrophin Receptor) using this Anti-p75NTR (Neurotrophin Receptor) Antibody validated for use in IH, IP & WB. pricing
05-446 Anti-p75NTR (Neurotrophin Receptor) Antibody, clone ME20.4 Anti-p75NTR (Neurotrophin Receptor) Antibody, clone ME20.4 detects level of p75NTR (Neurotrophin Receptor) & has been published & validated for use in IP, WB, IH, NEUT. pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002507 Rosetta Predictions human pricing
NM_012610 Rosetta Predictions rat pricing
NM_033217 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002507 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00043079 predicted 975
2 SASI_Hs01_00043080 predicted 864
3 SASI_Hs01_00043081 predicted 1240
4 SASI_Hs01_00043082 predicted 683
5 SASI_Hs01_00043083 predicted 969
6 SASI_Hs01_00043084 predicted 365
7 SASI_Hs01_00043085 predicted 971
8 SASI_Hs01_00043086 predicted 1218
9 SASI_Hs01_00043087 predicted 869
10 SASI_Hs01_00043088 predicted 1220
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012610 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00067671 predicted 1850
2 SASI_Rn01_00067672 predicted 914
3 SASI_Rn01_00067673 predicted 788
4 SASI_Rn01_00067674 predicted 1341
5 SASI_Rn01_00067675 predicted 772
6 SASI_Rn01_00067676 predicted 857
7 SASI_Rn01_00067677 predicted 930
8 SASI_Rn01_00067678 predicted 1334
9 SASI_Rn01_00067679 predicted 1214
10 SASI_Rn01_00067680 predicted 354
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033217 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00085401 predicted 937
2 SASI_Mm01_00085403 predicted 1907
3 SASI_Mm01_00085404 predicted 1657
4 SASI_Mm02_00337315 predicted 1615
5 SASI_Mm01_00085405 predicted 425
6 SASI_Mm01_00085406 predicted 1876
7 SASI_Mm01_00085407 predicted 1716
8 SASI_Mm01_00085408 predicted 1233
9 SASI_Mm01_00085409 predicted 1777
10 SASI_Mm01_00085410 predicted 896
11 SASI_Mm01_00085402 predicted 1926
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033217
NGFR MISSION shRNA Bacterial Glycerol Stock
nerve growth factor receptor
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000065554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033217.1-753s1c1
Sequence:CCGGACAACCTCATTCCTGTCTATTCTCGAGAATAGACAGGAATGAGGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033217.1-458s1c1
Sequence:CCGGGAGGGCACATACTCAGATGAACTCGAGTTCATCTGAGTATGTGCCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033217.1-97s1c1
Sequence:CCGGGACATGTTCCACAGGCATGTACTCGAGTACATGCCTGTGGAACATGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033217.1-328s1c1
Sequence:CCGGCCGATGCTCCTATGGCTACTACTCGAGTAGTAGCCATAGGAGCATCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033217
NGFR MISSION shRNA shRNA Plasmid DNA
nerve growth factor receptor
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000065554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033217.1-753s1c1
Sequence:CCGGACAACCTCATTCCTGTCTATTCTCGAGAATAGACAGGAATGAGGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033217.1-458s1c1
Sequence:CCGGGAGGGCACATACTCAGATGAACTCGAGTTCATCTGAGTATGTGCCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033217.1-97s1c1
Sequence:CCGGGACATGTTCCACAGGCATGTACTCGAGTACATGCCTGTGGAACATGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033217.1-328s1c1
Sequence:CCGGCCGATGCTCCTATGGCTACTACTCGAGTAGTAGCCATAGGAGCATCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033217
NGFR MISSION shRNA Lentiviral Transduction Particles
nerve growth factor receptor
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000065554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033217.1-753s1c1
Sequence:CCGGACAACCTCATTCCTGTCTATTCTCGAGAATAGACAGGAATGAGGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033217.1-458s1c1
Sequence:CCGGGAGGGCACATACTCAGATGAACTCGAGTTCATCTGAGTATGTGCCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065557    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033217.1-97s1c1
Sequence:CCGGGACATGTTCCACAGGCATGTACTCGAGTACATGCCTGTGGAACATGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033217.1-328s1c1
Sequence:CCGGCCGATGCTCCTATGGCTACTACTCGAGTAGTAGCCATAGGAGCATCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002507
NGFR MISSION shRNA Bacterial Glycerol Stock
nerve growth factor receptor
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000058153    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002507.1-3021s1c1
Sequence:CCGGGCACTGTAGTAAATGGCAATTCTCGAGAATTGCCATTTACTACAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002507.1-1222s1c1
Sequence:CCGGCCGAGCACATAGACTCCTTTACTCGAGTAAAGGAGTCTATGTGCTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002507.1-858s1c1
Sequence:CCGGGACAACCTCATCCCTGTCTATCTCGAGATAGACAGGGATGAGGTTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002507.1-441s1c1
Sequence:CCGGGCCTACGGCTACTACCAGGATCTCGAGATCCTGGTAGTAGCCGTAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002507.1-765s1c1
Sequence:CCGGCCTCCAGAACAAGACCTCATACTCGAGTATGAGGTCTTGTTCTGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002507
NGFR MISSION shRNA shRNA Plasmid DNA
nerve growth factor receptor
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000058153    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002507.1-3021s1c1
Sequence:CCGGGCACTGTAGTAAATGGCAATTCTCGAGAATTGCCATTTACTACAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002507.1-1222s1c1
Sequence:CCGGCCGAGCACATAGACTCCTTTACTCGAGTAAAGGAGTCTATGTGCTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002507.1-858s1c1
Sequence:CCGGGACAACCTCATCCCTGTCTATCTCGAGATAGACAGGGATGAGGTTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002507.1-441s1c1
Sequence:CCGGGCCTACGGCTACTACCAGGATCTCGAGATCCTGGTAGTAGCCGTAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002507.1-765s1c1
Sequence:CCGGCCTCCAGAACAAGACCTCATACTCGAGTATGAGGTCTTGTTCTGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002507
NGFR MISSION shRNA Lentiviral Transduction Particles
nerve growth factor receptor
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000058153    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002507.1-3021s1c1
Sequence:CCGGGCACTGTAGTAAATGGCAATTCTCGAGAATTGCCATTTACTACAGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002507.1-1222s1c1
Sequence:CCGGCCGAGCACATAGACTCCTTTACTCGAGTAAAGGAGTCTATGTGCTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002507.1-858s1c1
Sequence:CCGGGACAACCTCATCCCTGTCTATCTCGAGATAGACAGGGATGAGGTTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002507.1-441s1c1
Sequence:CCGGGCCTACGGCTACTACCAGGATCTCGAGATCCTGGTAGTAGCCGTAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002507.1-765s1c1
Sequence:CCGGCCTCCAGAACAAGACCTCATACTCGAGTATGAGGTCTTGTTCTGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)