EMAIL THIS PAGE TO A FRIEND

NGFRAP1

nerve growth factor receptor (TNFRSF16) associated protein 1

117 Gene Product Result for
Synonyms: BEX3 Bex DXS6984E HGR74 NADE
UniProtKB ID: Q00994, B2RD17, D3DXA3, Q5JQT4, Q5JQT5
Gene ID:
Mouse(12070) nerve growth factor receptor (TNFRSF16) associated protein 1
Rat(117089) nerve growth factor receptor (TNFRSF16) associated protein 1
domestic cat(101095802) nerve growth factor receptor (TNFRSF16) associated protein 1
cow(100034674) nerve growth factor receptor (TNFRSF16) associated protein 1
dog(100682628) nerve growth factor receptor (TNFRSF16) associated protein 1
naked mole-rat(101701538) nerve growth factor receptor (TNFRSF16) associated protein 1
domestic guinea pig(100727866) nerve growth factor receptor (TNFRSF16) associated protein 1
sheep(101117650) nerve growth factor receptor (TNFRSF16) associated protein 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014380 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014380 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014380 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009750 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009750 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009750 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014380 Rosetta Predictions human pricing
NM_206915 Rosetta Predictions human pricing
NM_206917 Rosetta Predictions human pricing
NM_053401 Rosetta Predictions rat pricing
NM_001110233 Rosetta Predictions mouse pricing
NM_001110234 Rosetta Predictions mouse pricing
NM_009750 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014380 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00091645 predicted 642
2 SASI_Hs01_00091646 predicted 637
3 SASI_Hs01_00091647 predicted 563
4 SASI_Hs01_00091648 predicted 569
5 SASI_Hs01_00091649 predicted 635
6 SASI_Hs01_00091650 predicted 650
7 SASI_Hs01_00091651 predicted 646
8 SASI_Hs01_00091653 predicted 643
9 SASI_Hs02_00345538 predicted 637
10 SASI_Hs01_00091654 predicted 558
11 SASI_Hs01_00091652 predicted 651
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_206915 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00216204 predicted 710
2 SASI_Hs01_00216205 predicted 707
3 SASI_Hs01_00216206 predicted 640
4 SASI_Hs01_00216207 predicted 633
5 SASI_Hs01_00216208 predicted 706
6 SASI_Hs01_00216209 predicted 719
7 SASI_Hs01_00216210 predicted 720
8 SASI_Hs01_00216212 predicted 720
9 SASI_Hs02_00373604 predicted 703
10 SASI_Hs01_00216213 predicted 633
11 SASI_Hs01_00216211 predicted 721
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_206917 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00064630 predicted 662
2 SASI_Hs01_00064631 predicted 656
3 SASI_Hs01_00064632 predicted 594
4 SASI_Hs01_00064633 predicted 590
5 SASI_Hs01_00064634 predicted 657
6 SASI_Hs01_00064635 predicted 672
7 SASI_Hs01_00064636 predicted 665
8 SASI_Hs01_00064638 predicted 675
9 SASI_Hs02_00373605 predicted 663
10 SASI_Hs01_00064639 predicted 584
11 SASI_Hs01_00064637 predicted 676
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053401 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00080349 predicted 477
2 SASI_Rn01_00080350 predicted 373
3 SASI_Rn01_00080351 predicted 322
4 SASI_Rn01_00080353 predicted 394
5 SASI_Rn01_00080354 predicted 437
6 SASI_Rn01_00080355 predicted 367
7 SASI_Rn01_00080356 predicted 429
8 SASI_Rn01_00080357 predicted 426
9 SASI_Rn01_00080358 predicted 217
10 SASI_Rn02_00265903 predicted 316
11 SASI_Rn01_00080352 predicted 293
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001110233 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00305106 predicted 580
2 SASI_Mm02_00305107 predicted 643
3 SASI_Mm02_00305108 predicted 591
4 SASI_Mm02_00305109 predicted 689
5 SASI_Mm02_00305110 predicted 576
6 SASI_Mm02_00305111 predicted 591
7 SASI_Mm02_00305112 predicted 603
8 SASI_Mm02_00305113 predicted 690
9 SASI_Mm02_00305114 predicted 596
10 SASI_Mm02_00305115 predicted 536
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001110234 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00305116 predicted 611
2 SASI_Mm02_00305117 predicted 552
3 SASI_Mm02_00305118 predicted 643
4 SASI_Mm02_00305119 predicted 554
5 SASI_Mm02_00305120 predicted 561
6 SASI_Mm02_00305121 predicted 644
7 SASI_Mm02_00305122 predicted 556
8 SASI_Mm02_00305123 predicted 489
9 SASI_Mm02_00305124 predicted 462
10 SASI_Mm02_00305125 predicted 788
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009750 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00048683 predicted 653
2 SASI_Mm01_00048684 predicted 597
3 SASI_Mm01_00048688 predicted 687
4 SASI_Mm01_00048685 predicted 602
5 SASI_Mm01_00048686 predicted 606
6 SASI_Mm01_00048689 predicted 689
7 SASI_Mm01_00048687 predicted 594
8 SASI_Mm01_00048690 predicted 539
9 SASI_Mm01_00048691 predicted 511
10 SASI_Mm02_00316937 predicted 836
11 SASI_Mm01_00048692 predicted 461
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014380
VALIDATED
NGFRAP1 MISSION shRNA Bacterial Glycerol Stock
nerve growth factor receptor (TNFRSF16) associated protein 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000061030    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_014380.1-351s1c1
Sequence:CCGGCCTATGCAGAATGGAGAGGAACTCGAGTTCCTCTCCATTCTGCATAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014380.1-600s1c1
Sequence:CCGGCTCTCTAATCACCATGACCATCTCGAGATGGTCATGGTGATTAGAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061032    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_014380.1-526s1c1
Sequence:CCGGAGGAGATGAGAGAAATCAGAACTCGAGTTCTGATTTCTCTCATCTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061029    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014380.1-461s1c1
Sequence:CCGGCATACCCAATAGGCAGATCAACTCGAGTTGATCTGCCTATTGGGTATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303797    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_014380.1-672s21c1
Sequence:CCGGATACTGTGATTCCCGCTGTTTCTCGAGAAACAGCGGGAATCACAGTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300001    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_014380.1-351s21c1
Sequence:CCGGCCTATGCAGAATGGAGAGGAACTCGAGTTCCTCTCCATTCTGCATAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300004    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_014380.1-526s21c1
Sequence:CCGGAGGAGATGAGAGAAATCAGAACTCGAGTTCTGATTTCTCTCATCTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303798    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_014380.1-572s21c1
Sequence:CCGGGAATTGTCTGCGTATCCTTATCTCGAGATAAGGATACGCAGACAATTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303852    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014380.1-641s21c1
Sequence:CCGGGCCTTGACTCCTGCCATTTATCTCGAGATAAATGGCAGGAGTCAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014380
VALIDATED
NGFRAP1 MISSION shRNA shRNA Plasmid DNA
nerve growth factor receptor (TNFRSF16) associated protein 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000061030    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_014380.1-351s1c1
Sequence:CCGGCCTATGCAGAATGGAGAGGAACTCGAGTTCCTCTCCATTCTGCATAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014380.1-600s1c1
Sequence:CCGGCTCTCTAATCACCATGACCATCTCGAGATGGTCATGGTGATTAGAGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061032    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_014380.1-526s1c1
Sequence:CCGGAGGAGATGAGAGAAATCAGAACTCGAGTTCTGATTTCTCTCATCTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061029    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014380.1-461s1c1
Sequence:CCGGCATACCCAATAGGCAGATCAACTCGAGTTGATCTGCCTATTGGGTATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000303797    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_014380.1-672s21c1
Sequence:CCGGATACTGTGATTCCCGCTGTTTCTCGAGAAACAGCGGGAATCACAGTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000300001    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_014380.1-351s21c1
Sequence:CCGGCCTATGCAGAATGGAGAGGAACTCGAGTTCCTCTCCATTCTGCATAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000300004    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_014380.1-526s21c1
Sequence:CCGGAGGAGATGAGAGAAATCAGAACTCGAGTTCTGATTTCTCTCATCTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000303798    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_014380.1-572s21c1
Sequence:CCGGGAATTGTCTGCGTATCCTTATCTCGAGATAAGGATACGCAGACAATTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000303852    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014380.1-641s21c1
Sequence:CCGGGCCTTGACTCCTGCCATTTATCTCGAGATAAATGGCAGGAGTCAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014380
VALIDATED
NGFRAP1 MISSION shRNA Lentiviral Transduction Particles
nerve growth factor receptor (TNFRSF16) associated protein 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000061030    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_014380.1-351s1c1
Sequence:CCGGCCTATGCAGAATGGAGAGGAACTCGAGTTCCTCTCCATTCTGCATAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014380.1-600s1c1
Sequence:CCGGCTCTCTAATCACCATGACCATCTCGAGATGGTCATGGTGATTAGAGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061032    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_014380.1-526s1c1
Sequence:CCGGAGGAGATGAGAGAAATCAGAACTCGAGTTCTGATTTCTCTCATCTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061029    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014380.1-461s1c1
Sequence:CCGGCATACCCAATAGGCAGATCAACTCGAGTTGATCTGCCTATTGGGTATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303797    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_014380.1-672s21c1
Sequence:CCGGATACTGTGATTCCCGCTGTTTCTCGAGAAACAGCGGGAATCACAGTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300001    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_014380.1-351s21c1
Sequence:CCGGCCTATGCAGAATGGAGAGGAACTCGAGTTCCTCTCCATTCTGCATAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300004    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_014380.1-526s21c1
Sequence:CCGGAGGAGATGAGAGAAATCAGAACTCGAGTTCTGATTTCTCTCATCTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303798    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_014380.1-572s21c1
Sequence:CCGGGAATTGTCTGCGTATCCTTATCTCGAGATAAGGATACGCAGACAATTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000303852    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014380.1-641s21c1
Sequence:CCGGGCCTTGACTCCTGCCATTTATCTCGAGATAAATGGCAGGAGTCAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009750
VALIDATED
NGFRAP1 MISSION shRNA Bacterial Glycerol Stock
nerve growth factor receptor (TNFRSF16) associated protein 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000306450    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009750.2-509s21c1
Sequence:CCGGATGAGAGAGATCCGGAGAAAGCTCGAGCTTTCTCCGGATCTCTCTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124634    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009750.1-688s1c1
Sequence:CCGGGCCAGCTTCTAATTGGAGATTCTCGAGAATCTCCAATTAGAAGCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124637    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009750.1-510s1c1
Sequence:CCGGCCACGATCACCATGATGAATTCTCGAGAATTCATCATGGTGATCGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124635    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009750.1-465s1c1
Sequence:CCGGGCTGAGAAATTGTCTACGCATCTCGAGATGCGTAGACAATTTCTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124638    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009750.1-399s1c1
Sequence:CCGGTGGAGATGATATGGAAATGTTCTCGAGAACATTTCCATATCATCTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124636    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009750.1-360s1c1
Sequence:CCGGCATTCCCAACAGGCAGATGAACTCGAGTTCATCTGCCTGTTGGGAATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332418    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009750.2-589s21c1
Sequence:CCGGCCACGATCACCATGATGAATTCTCGAGAATTCATCATGGTGATCGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306449    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009750.2-617s21c1
Sequence:CCGGATGCCTTGACTTCGGTCATTCCTCGAGGAATGACCGAAGTCAAGGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332419    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009750.2-544s21c1
Sequence:CCGGGCTGAGAAATTGTCTACGCATCTCGAGATGCGTAGACAATTTCTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306389    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009750.2-716s21c1
Sequence:CCGGGTGGTGAGCCTTGTGTTATTTCTCGAGAAATAACACAAGGCTCACCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009750
VALIDATED
NGFRAP1 MISSION shRNA shRNA Plasmid DNA
nerve growth factor receptor (TNFRSF16) associated protein 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000306450    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009750.2-509s21c1
Sequence:CCGGATGAGAGAGATCCGGAGAAAGCTCGAGCTTTCTCCGGATCTCTCTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124634    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009750.1-688s1c1
Sequence:CCGGGCCAGCTTCTAATTGGAGATTCTCGAGAATCTCCAATTAGAAGCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124637    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009750.1-510s1c1
Sequence:CCGGCCACGATCACCATGATGAATTCTCGAGAATTCATCATGGTGATCGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124635    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009750.1-465s1c1
Sequence:CCGGGCTGAGAAATTGTCTACGCATCTCGAGATGCGTAGACAATTTCTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124638    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009750.1-399s1c1
Sequence:CCGGTGGAGATGATATGGAAATGTTCTCGAGAACATTTCCATATCATCTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124636    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009750.1-360s1c1
Sequence:CCGGCATTCCCAACAGGCAGATGAACTCGAGTTCATCTGCCTGTTGGGAATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332418    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009750.2-589s21c1
Sequence:CCGGCCACGATCACCATGATGAATTCTCGAGAATTCATCATGGTGATCGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306449    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009750.2-617s21c1
Sequence:CCGGATGCCTTGACTTCGGTCATTCCTCGAGGAATGACCGAAGTCAAGGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332419    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009750.2-544s21c1
Sequence:CCGGGCTGAGAAATTGTCTACGCATCTCGAGATGCGTAGACAATTTCTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306389    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009750.2-716s21c1
Sequence:CCGGGTGGTGAGCCTTGTGTTATTTCTCGAGAAATAACACAAGGCTCACCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009750
VALIDATED
NGFRAP1 MISSION shRNA Lentiviral Transduction Particles
nerve growth factor receptor (TNFRSF16) associated protein 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000306450    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009750.2-509s21c1
Sequence:CCGGATGAGAGAGATCCGGAGAAAGCTCGAGCTTTCTCCGGATCTCTCTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124634    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009750.1-688s1c1
Sequence:CCGGGCCAGCTTCTAATTGGAGATTCTCGAGAATCTCCAATTAGAAGCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124637    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009750.1-510s1c1
Sequence:CCGGCCACGATCACCATGATGAATTCTCGAGAATTCATCATGGTGATCGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124635    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009750.1-465s1c1
Sequence:CCGGGCTGAGAAATTGTCTACGCATCTCGAGATGCGTAGACAATTTCTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124638    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009750.1-399s1c1
Sequence:CCGGTGGAGATGATATGGAAATGTTCTCGAGAACATTTCCATATCATCTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124636    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009750.1-360s1c1
Sequence:CCGGCATTCCCAACAGGCAGATGAACTCGAGTTCATCTGCCTGTTGGGAATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332418    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009750.2-589s21c1
Sequence:CCGGCCACGATCACCATGATGAATTCTCGAGAATTCATCATGGTGATCGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306449    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009750.2-617s21c1
Sequence:CCGGATGCCTTGACTTCGGTCATTCCTCGAGGAATGACCGAAGTCAAGGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332419    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009750.2-544s21c1
Sequence:CCGGGCTGAGAAATTGTCTACGCATCTCGAGATGCGTAGACAATTTCTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306389    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009750.2-716s21c1
Sequence:CCGGGTGGTGAGCCTTGTGTTATTTCTCGAGAAATAACACAAGGCTCACCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)