EMAIL THIS PAGE TO A FRIEND

NGLY1

N-glycanase 1

67 Gene Product Result for
Synonyms: CDG1V PNG1 PNGase
UniProtKB ID: Q96IV0, B4DJE9, Q59FB1, Q6PJD8, Q9BVR8, Q9NR70
Gene ID:
Human(55768) Summary: This gene encodes an enzyme that catalyzes hydrolysis of an N(4)-(acetyl-beta-D-glucosaminyl) asparagine residue to N-acetyl-beta-D-glucosaminylamine and a peptide containing an aspartate residue. The encoded enzyme may play a role in the proteasome-mediated degradation of misfolded glycoproteins. Multiple transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Feb 2009]
Mouse(59007) N-glycanase 1
Rat(361014) N-glycanase 1
Zebrafish(553627) N-glycanase 1
chicken(420655) N-glycanase 1
dog(100682555) N-glycanase 1
domestic cat(101086171) N-glycanase 1
cow(533736) N-glycanase 1
Horse(100059456) N-glycanase 1
sheep(101122164) N-glycanase 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018297 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018297 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018297 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_021504 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021504 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021504 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018297 Rosetta Predictions human pricing
NM_001014136 Rosetta Predictions rat pricing
NM_021504 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018297 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00143400 predicted 1201
2 SASI_Hs01_00143401 predicted 1271
3 SASI_Hs02_00351698 predicted 453
4 SASI_Hs02_00351699 predicted 1258
5 SASI_Hs01_00143402 predicted 220
6 SASI_Hs01_00143405 predicted 1796
7 SASI_Hs01_00143406 predicted 599
8 SASI_Hs02_00351700 predicted 1426
9 SASI_Hs01_00143407 predicted 1733
10 SASI_Hs01_00143408 predicted 614
11 SASI_Hs01_00143403 predicted 819
12 SASI_Hs01_00143404 predicted 1539
13 SASI_Hs01_00143409 predicted 1706
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014136 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00032842 predicted 1287
2 SASI_Rn01_00032843 predicted 253
3 SASI_Rn01_00032845 predicted 720
4 SASI_Rn01_00032846 predicted 1039
5 SASI_Rn01_00032847 predicted 1743
6 SASI_Rn01_00032848 predicted 1273
7 SASI_Rn01_00032849 predicted 1421
8 SASI_Rn01_00032850 predicted 1978
9 SASI_Rn02_00201594 predicted 1716
10 SASI_Rn02_00201595 predicted 964
11 SASI_Rn01_00032841 predicted 1195
12 SASI_Rn01_00032844 predicted 766
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021504 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00326216 predicted 698
2 SASI_Mm01_00100508 predicted 1833
3 SASI_Mm01_00100509 predicted 527
4 SASI_Mm01_00100511 predicted 683
5 SASI_Mm01_00100512 predicted 1025
6 SASI_Mm01_00100513 predicted 1268
7 SASI_Mm01_00100514 predicted 396
8 SASI_Mm01_00100515 predicted 1175
9 SASI_Mm01_00100516 predicted 941
10 SASI_Mm01_00100517 predicted 1645
11 SASI_Mm01_00100510 predicted 236
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018297
VALIDATED
NGLY1 MISSION shRNA Bacterial Glycerol Stock
N-glycanase 1
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000370500    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018297.3-1611s21c1
Sequence:CCGGAGATCGTTATGTTCGAGTTTCCTCGAGGAAACTCGAACATAACGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370501    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018297.3-2219s21c1
Sequence:CCGGTATCTTTATACGTGGACTATACTCGAGTATAGTCCACGTATAAAGATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300951    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018297.3-1864s21c1
Sequence:CCGGCGATCTGATACAGCACAAGTACTCGAGTACTTGTGCTGTATCAGATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304166    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018297.3-1332s21c1
Sequence:CCGGATTACTTCGAGACACTATTAACTCGAGTTAATAGTGTCTCGAAGTAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304238    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018297.3-1262s21c1
Sequence:CCGGTTGATGTCACTTGGCGATATTCTCGAGAATATCGCCAAGTGACATCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304229    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018297.3-2160s21c1
Sequence:CCGGCCACCCTGTGCTAGCATATTTCTCGAGAAATATGCTAGCACAGGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118217    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018297.2-2028s1c1
Sequence:CCGGGCTGGCAATAATCAAGGACTTCTCGAGAAGTCCTTGATTATTGCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018297.2-1797s1c1
Sequence:CCGGCGATCTGATACAGCACAAGTACTCGAGTACTTGTGCTGTATCAGATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118218    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018297.2-1517s1c1
Sequence:CCGGGCTCCACCTTTGTTACAATATCTCGAGATATTGTAACAAAGGTGGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018297.2-1796s1c1
Sequence:CCGGGCGATCTGATACAGCACAAGTCTCGAGACTTGTGCTGTATCAGATCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018297.2-1158s1c1
Sequence:CCGGCTTTCCTATGTCATAGCATTTCTCGAGAAATGCTATGACATAGGAAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018297
VALIDATED
NGLY1 MISSION shRNA shRNA Plasmid DNA
N-glycanase 1
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000370500    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018297.3-1611s21c1
Sequence:CCGGAGATCGTTATGTTCGAGTTTCCTCGAGGAAACTCGAACATAACGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000370501    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018297.3-2219s21c1
Sequence:CCGGTATCTTTATACGTGGACTATACTCGAGTATAGTCCACGTATAAAGATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000300951    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018297.3-1864s21c1
Sequence:CCGGCGATCTGATACAGCACAAGTACTCGAGTACTTGTGCTGTATCAGATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304166    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018297.3-1332s21c1
Sequence:CCGGATTACTTCGAGACACTATTAACTCGAGTTAATAGTGTCTCGAAGTAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304238    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018297.3-1262s21c1
Sequence:CCGGTTGATGTCACTTGGCGATATTCTCGAGAATATCGCCAAGTGACATCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304229    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018297.3-2160s21c1
Sequence:CCGGCCACCCTGTGCTAGCATATTTCTCGAGAAATATGCTAGCACAGGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118217    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018297.2-2028s1c1
Sequence:CCGGGCTGGCAATAATCAAGGACTTCTCGAGAAGTCCTTGATTATTGCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018297.2-1797s1c1
Sequence:CCGGCGATCTGATACAGCACAAGTACTCGAGTACTTGTGCTGTATCAGATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118218    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018297.2-1517s1c1
Sequence:CCGGGCTCCACCTTTGTTACAATATCTCGAGATATTGTAACAAAGGTGGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018297.2-1796s1c1
Sequence:CCGGGCGATCTGATACAGCACAAGTCTCGAGACTTGTGCTGTATCAGATCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018297.2-1158s1c1
Sequence:CCGGCTTTCCTATGTCATAGCATTTCTCGAGAAATGCTATGACATAGGAAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018297
VALIDATED
NGLY1 MISSION shRNA Lentiviral Transduction Particles
N-glycanase 1
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000370500    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018297.3-1611s21c1
Sequence:CCGGAGATCGTTATGTTCGAGTTTCCTCGAGGAAACTCGAACATAACGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370501    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018297.3-2219s21c1
Sequence:CCGGTATCTTTATACGTGGACTATACTCGAGTATAGTCCACGTATAAAGATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300951    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018297.3-1864s21c1
Sequence:CCGGCGATCTGATACAGCACAAGTACTCGAGTACTTGTGCTGTATCAGATCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304166    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018297.3-1332s21c1
Sequence:CCGGATTACTTCGAGACACTATTAACTCGAGTTAATAGTGTCTCGAAGTAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304238    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018297.3-1262s21c1
Sequence:CCGGTTGATGTCACTTGGCGATATTCTCGAGAATATCGCCAAGTGACATCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304229    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018297.3-2160s21c1
Sequence:CCGGCCACCCTGTGCTAGCATATTTCTCGAGAAATATGCTAGCACAGGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118217    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018297.2-2028s1c1
Sequence:CCGGGCTGGCAATAATCAAGGACTTCTCGAGAAGTCCTTGATTATTGCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018297.2-1797s1c1
Sequence:CCGGCGATCTGATACAGCACAAGTACTCGAGTACTTGTGCTGTATCAGATCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118218    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018297.2-1517s1c1
Sequence:CCGGGCTCCACCTTTGTTACAATATCTCGAGATATTGTAACAAAGGTGGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018297.2-1796s1c1
Sequence:CCGGGCGATCTGATACAGCACAAGTCTCGAGACTTGTGCTGTATCAGATCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018297.2-1158s1c1
Sequence:CCGGCTTTCCTATGTCATAGCATTTCTCGAGAAATGCTATGACATAGGAAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021504
VALIDATED
NGLY1 MISSION shRNA Bacterial Glycerol Stock
N-glycanase 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000304752    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021504.3-1011s21c1
Sequence:CCGGTTAGGGTTTGAAGCTCGATATCTCGAGATATCGAGCTTCAAACCCTAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304698    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021504.3-1866s21c1
Sequence:CCGGGGTGCCACAGAGGTTACATTACTCGAGTAATGTAACCTCTGTGGCACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316053    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021504.3-528s21c1
Sequence:CCGGGCTCCAATGGTTGTTGGTGATCTCGAGATCACCAACAACCATTGGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311123    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021504.3-2054s21c1
Sequence:CCGGCATGGCCTCCAGTAGTGTATTCTCGAGAATACACTACTGGAGGCCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311122    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021504.3-1913s21c1
Sequence:CCGGAGACGTTGCTTGGCAACATACCTCGAGGTATGTTGCCAAGCAACGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000092113    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021504.2-2215s1c1
Sequence:CCGGCCTGTGATTAGAATTTGGCATCTCGAGATGCCAAATTCTAATCACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000092115    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021504.2-1690s1c1
Sequence:CCGGGCTTATATTTCCTGGAAGTTTCTCGAGAAACTTCCAGGAAATATAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000092117    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021504.2-911s1c1
Sequence:CCGGGCAACCGCTTCCCAAGATATACTCGAGTATATCTTGGGAAGCGGTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000092116    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021504.2-529s1c1
Sequence:CCGGGCTCCAATGGTTGTTGGTGATCTCGAGATCACCAACAACCATTGGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000092114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021504.2-1130s1c1
Sequence:CCGGCCCTCCTTTATGAAATAGGATCTCGAGATCCTATTTCATAAAGGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021504
VALIDATED
NGLY1 MISSION shRNA shRNA Plasmid DNA
N-glycanase 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000304752    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021504.3-1011s21c1
Sequence:CCGGTTAGGGTTTGAAGCTCGATATCTCGAGATATCGAGCTTCAAACCCTAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304698    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021504.3-1866s21c1
Sequence:CCGGGGTGCCACAGAGGTTACATTACTCGAGTAATGTAACCTCTGTGGCACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000316053    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021504.3-528s21c1
Sequence:CCGGGCTCCAATGGTTGTTGGTGATCTCGAGATCACCAACAACCATTGGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000311123    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021504.3-2054s21c1
Sequence:CCGGCATGGCCTCCAGTAGTGTATTCTCGAGAATACACTACTGGAGGCCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000311122    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021504.3-1913s21c1
Sequence:CCGGAGACGTTGCTTGGCAACATACCTCGAGGTATGTTGCCAAGCAACGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000092113    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021504.2-2215s1c1
Sequence:CCGGCCTGTGATTAGAATTTGGCATCTCGAGATGCCAAATTCTAATCACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000092115    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021504.2-1690s1c1
Sequence:CCGGGCTTATATTTCCTGGAAGTTTCTCGAGAAACTTCCAGGAAATATAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000092117    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021504.2-911s1c1
Sequence:CCGGGCAACCGCTTCCCAAGATATACTCGAGTATATCTTGGGAAGCGGTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000092116    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021504.2-529s1c1
Sequence:CCGGGCTCCAATGGTTGTTGGTGATCTCGAGATCACCAACAACCATTGGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000092114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021504.2-1130s1c1
Sequence:CCGGCCCTCCTTTATGAAATAGGATCTCGAGATCCTATTTCATAAAGGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021504
VALIDATED
NGLY1 MISSION shRNA Lentiviral Transduction Particles
N-glycanase 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000304752    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021504.3-1011s21c1
Sequence:CCGGTTAGGGTTTGAAGCTCGATATCTCGAGATATCGAGCTTCAAACCCTAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304698    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021504.3-1866s21c1
Sequence:CCGGGGTGCCACAGAGGTTACATTACTCGAGTAATGTAACCTCTGTGGCACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316053    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021504.3-528s21c1
Sequence:CCGGGCTCCAATGGTTGTTGGTGATCTCGAGATCACCAACAACCATTGGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311123    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021504.3-2054s21c1
Sequence:CCGGCATGGCCTCCAGTAGTGTATTCTCGAGAATACACTACTGGAGGCCATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311122    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021504.3-1913s21c1
Sequence:CCGGAGACGTTGCTTGGCAACATACCTCGAGGTATGTTGCCAAGCAACGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000092113    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021504.2-2215s1c1
Sequence:CCGGCCTGTGATTAGAATTTGGCATCTCGAGATGCCAAATTCTAATCACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000092115    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021504.2-1690s1c1
Sequence:CCGGGCTTATATTTCCTGGAAGTTTCTCGAGAAACTTCCAGGAAATATAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000092117    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021504.2-911s1c1
Sequence:CCGGGCAACCGCTTCCCAAGATATACTCGAGTATATCTTGGGAAGCGGTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000092116    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021504.2-529s1c1
Sequence:CCGGGCTCCAATGGTTGTTGGTGATCTCGAGATCACCAACAACCATTGGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000092114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021504.2-1130s1c1
Sequence:CCGGCCCTCCTTTATGAAATAGGATCTCGAGATCCTATTTCATAAAGGAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)