EMAIL THIS PAGE TO A FRIEND

NHEJ1

nonhomologous end-joining factor 1

74 Gene Product Result for
Synonyms: XLF
UniProtKB ID: Q9H9Q4, B8ZZA4, Q4ZFW7, Q6IA64, Q96JS9
Gene ID:
Human(79840) Summary: Double-strand breaks in DNA result from genotoxic stresses and are among the most damaging of DNA lesions. This gene encodes a DNA repair factor essential for the nonhomologous end-joining pathway, which preferentially mediates repair of double-stranded breaks. Mutations in this gene cause different kinds of severe combined immunodeficiency disorders. [provided by RefSeq, Jul 2008]
Mouse(75570) nonhomologous end-joining factor 1
Rat(363251) nonhomologous end-joining factor 1
Zebrafish(406593) nonhomologous end-joining factor 1
chicken(424205) nonhomologous end-joining factor 1
domestic cat(101092956) nonhomologous end-joining factor 1
cow(509157) nonhomologous end-joining factor 1
dog(610570) nonhomologous end-joining factor 1
naked mole-rat(101726729) nonhomologous end-joining factor 1
domestic guinea pig(100713065) nonhomologous end-joining factor 1
sheep(101113915) nonhomologous end-joining factor 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024782 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024782 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024782 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_029342 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029342 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029342 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU095931 MISSION® esiRNA esiRNA human NHEJ1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024782 Rosetta Predictions human pricing
NM_001014217 Rosetta Predictions rat pricing
NM_029342 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024782 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00244354 predicted 453
2 SASI_Hs02_00357313 predicted 1465
3 SASI_Hs02_00357314 predicted 241
4 SASI_Hs02_00357315 predicted 1304
5 SASI_Hs01_00244362 predicted 351
6 SASI_Hs02_00357316 predicted 1479
7 SASI_Hs02_00357317 predicted 1166
8 SASI_Hs02_00357318 predicted 1487
9 SASI_Hs02_00357319 predicted 1204
10 SASI_Hs02_00357320 predicted 1088
11 SASI_Hs01_00244355 predicted 539
12 SASI_Hs01_00244356 predicted 366
13 SASI_Hs01_00244357 predicted 597
14 SASI_Hs01_00244358 predicted 830
15 SASI_Hs01_00244359 predicted 727
16 SASI_Hs01_00244360 predicted 540
17 SASI_Hs01_00244361 predicted 644
18 SASI_Hs01_00244363 predicted 513
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014217 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00059895 predicted 389
2 SASI_Rn01_00059896 predicted 767
3 SASI_Rn01_00059897 predicted 687
4 SASI_Rn01_00059898 predicted 954
5 SASI_Rn01_00059899 predicted 495
6 SASI_Rn01_00059900 predicted 861
7 SASI_Rn01_00059901 predicted 210
8 SASI_Rn01_00059902 predicted 685
9 SASI_Rn01_00059903 predicted 517
10 SASI_Rn01_00059904 predicted 743
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029342 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00041124 predicted 474
2 SASI_Mm01_00041125 predicted 528
3 SASI_Mm01_00041127 predicted 264
4 SASI_Mm01_00041128 predicted 233
5 SASI_Mm01_00041129 predicted 536
6 SASI_Mm01_00041130 predicted 275
7 SASI_Mm01_00041131 predicted 531
8 SASI_Mm01_00041132 predicted 786
9 SASI_Mm02_00335178 predicted 919
10 SASI_Mm02_00335179 predicted 641
11 SASI_Mm01_00041126 predicted 819
12 SASI_Mm01_00041133 predicted 369
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024782
VALIDATED
NHEJ1 MISSION shRNA Bacterial Glycerol Stock
nonhomologous end-joining factor 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000275700    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024782.2-542s21c1
Sequence:CCGGCCAACATTTGATTCGTCCTCTCTCGAGAGAGGACGAATCAAATGTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275629    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024782.2-706s21c1
Sequence:CCGGATTCCTTCTTGGAACAATTTACTCGAGTAAATTGTTCCAAGAAGGAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275631    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024782.2-564s21c1
Sequence:CCGGATGGGCATGAGTCTGGCATTACTCGAGTAATGCCAGACTCATGCCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275632    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024782.2-1297s21c1
Sequence:CCGGTACCATGGACTTTAGGTATATCTCGAGATATACCTAAAGTCCATGGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275628    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024782.2-602s21c1
Sequence:CCGGGCTAGCAACGTTACTTCATATCTCGAGATATGAAGTAACGTTGCTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000131120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024782.1-937s1c1
Sequence:CCGGGCTGTCAAAGGTCAAGAGGAACTCGAGTTCCTCTTGACCTTTGACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130632    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024782.1-478s1c1
Sequence:CCGGCCAACATTTGATTCGTCCTCTCTCGAGAGAGGACGAATCAAATGTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128742    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024782.1-614s1c1
Sequence:CCGGCGATTGAAGACAGAACCATTTCTCGAGAAATGGTTCTGTCTTCAATCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024782.1-836s1c1
Sequence:CCGGCAATGTGTAAACCAGCCAGAACTCGAGTTCTGGCTGGTTTACACATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024782.1-298s1c1
Sequence:CCGGCCTCTGTCATTTGGATAATCTCTCGAGAGATTATCCAAATGACAGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024782
VALIDATED
NHEJ1 MISSION shRNA shRNA Plasmid DNA
nonhomologous end-joining factor 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000275700    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024782.2-542s21c1
Sequence:CCGGCCAACATTTGATTCGTCCTCTCTCGAGAGAGGACGAATCAAATGTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275629    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024782.2-706s21c1
Sequence:CCGGATTCCTTCTTGGAACAATTTACTCGAGTAAATTGTTCCAAGAAGGAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275631    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024782.2-564s21c1
Sequence:CCGGATGGGCATGAGTCTGGCATTACTCGAGTAATGCCAGACTCATGCCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275632    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024782.2-1297s21c1
Sequence:CCGGTACCATGGACTTTAGGTATATCTCGAGATATACCTAAAGTCCATGGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275628    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024782.2-602s21c1
Sequence:CCGGGCTAGCAACGTTACTTCATATCTCGAGATATGAAGTAACGTTGCTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000131120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024782.1-937s1c1
Sequence:CCGGGCTGTCAAAGGTCAAGAGGAACTCGAGTTCCTCTTGACCTTTGACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130632    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024782.1-478s1c1
Sequence:CCGGCCAACATTTGATTCGTCCTCTCTCGAGAGAGGACGAATCAAATGTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128742    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024782.1-614s1c1
Sequence:CCGGCGATTGAAGACAGAACCATTTCTCGAGAAATGGTTCTGTCTTCAATCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024782.1-836s1c1
Sequence:CCGGCAATGTGTAAACCAGCCAGAACTCGAGTTCTGGCTGGTTTACACATTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024782.1-298s1c1
Sequence:CCGGCCTCTGTCATTTGGATAATCTCTCGAGAGATTATCCAAATGACAGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024782
VALIDATED
NHEJ1 MISSION shRNA Lentiviral Transduction Particles
nonhomologous end-joining factor 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000275700    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024782.2-542s21c1
Sequence:CCGGCCAACATTTGATTCGTCCTCTCTCGAGAGAGGACGAATCAAATGTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275629    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024782.2-706s21c1
Sequence:CCGGATTCCTTCTTGGAACAATTTACTCGAGTAAATTGTTCCAAGAAGGAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275631    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024782.2-564s21c1
Sequence:CCGGATGGGCATGAGTCTGGCATTACTCGAGTAATGCCAGACTCATGCCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275632    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024782.2-1297s21c1
Sequence:CCGGTACCATGGACTTTAGGTATATCTCGAGATATACCTAAAGTCCATGGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275628    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024782.2-602s21c1
Sequence:CCGGGCTAGCAACGTTACTTCATATCTCGAGATATGAAGTAACGTTGCTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000131120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024782.1-937s1c1
Sequence:CCGGGCTGTCAAAGGTCAAGAGGAACTCGAGTTCCTCTTGACCTTTGACAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130632    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024782.1-478s1c1
Sequence:CCGGCCAACATTTGATTCGTCCTCTCTCGAGAGAGGACGAATCAAATGTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128742    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024782.1-614s1c1
Sequence:CCGGCGATTGAAGACAGAACCATTTCTCGAGAAATGGTTCTGTCTTCAATCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024782.1-836s1c1
Sequence:CCGGCAATGTGTAAACCAGCCAGAACTCGAGTTCTGGCTGGTTTACACATTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024782.1-298s1c1
Sequence:CCGGCCTCTGTCATTTGGATAATCTCTCGAGAGATTATCCAAATGACAGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029342
VALIDATED
NHEJ1 MISSION shRNA Bacterial Glycerol Stock
nonhomologous end-joining factor 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000254005    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029342.4-1207s21c1
Sequence:CCGGACTCACTGGCATTCCGGATATCTCGAGATATCCGGAATGCCAGTGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254007    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029342.4-511s21c1
Sequence:CCGGTCTTCCCTTCAGTTGGCATTTCTCGAGAAATGCCAACTGAAGGGAAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254008    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029342.4-847s21c1
Sequence:CCGGCCAAGCAAGGCAGGCACATAACTCGAGTTATGTGCCTGCCTTGCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254006    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029342.4-252s21c1
Sequence:CCGGCTATCACCAAGCACGGTTATGCTCGAGCATAACCGTGCTTGGTGATAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254004    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029342.4-222s21c1
Sequence:CCGGTTGCGGAGAACTCACTCTTAGCTCGAGCTAAGAGTGAGTTCTCCGCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029342
VALIDATED
NHEJ1 MISSION shRNA shRNA Plasmid DNA
nonhomologous end-joining factor 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000254005    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029342.4-1207s21c1
Sequence:CCGGACTCACTGGCATTCCGGATATCTCGAGATATCCGGAATGCCAGTGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254007    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029342.4-511s21c1
Sequence:CCGGTCTTCCCTTCAGTTGGCATTTCTCGAGAAATGCCAACTGAAGGGAAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254008    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029342.4-847s21c1
Sequence:CCGGCCAAGCAAGGCAGGCACATAACTCGAGTTATGTGCCTGCCTTGCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254006    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029342.4-252s21c1
Sequence:CCGGCTATCACCAAGCACGGTTATGCTCGAGCATAACCGTGCTTGGTGATAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254004    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029342.4-222s21c1
Sequence:CCGGTTGCGGAGAACTCACTCTTAGCTCGAGCTAAGAGTGAGTTCTCCGCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029342
VALIDATED
NHEJ1 MISSION shRNA Lentiviral Transduction Particles
nonhomologous end-joining factor 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000254005    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029342.4-1207s21c1
Sequence:CCGGACTCACTGGCATTCCGGATATCTCGAGATATCCGGAATGCCAGTGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254007    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029342.4-511s21c1
Sequence:CCGGTCTTCCCTTCAGTTGGCATTTCTCGAGAAATGCCAACTGAAGGGAAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254008    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029342.4-847s21c1
Sequence:CCGGCCAAGCAAGGCAGGCACATAACTCGAGTTATGTGCCTGCCTTGCTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254006    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029342.4-252s21c1
Sequence:CCGGCTATCACCAAGCACGGTTATGCTCGAGCATAACCGTGCTTGGTGATAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254004    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029342.4-222s21c1
Sequence:CCGGTTGCGGAGAACTCACTCTTAGCTCGAGCTAAGAGTGAGTTCTCCGCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)