EMAIL THIS PAGE TO A FRIEND

NHLH1

nescient helix loop helix 1

78 Gene Product Result for
Synonyms: HEN1 NSCL NSCL1 bHLHa35
UniProtKB ID: Q02575
Gene ID:
Human(4807) Summary: The helix-loop-helix (HLH) proteins are a family of putative transcription factors, some of which have been shown to play an important role in growth and development of a wide variety of tissues and species. Four members of this family have been clearly implicated in tumorigenesis via their involvement in chromosomal translocations in lymphoid tumors: MYC (MIM 190080), LYL1 (MIM 151440), E2A (MIM 147141), and SCL (MIM 187040).[supplied by OMIM, Nov 2002]
Mouse(18071) nescient helix loop helix 1
Rat(289230) nescient helix loop helix 1
chicken(373910) nescient helix loop helix 1
cow(530196) nescient helix loop helix 1
dog(488639) nescient helix loop helix 1
sheep(101120713) nescient helix loop helix 1
domestic guinea pig(100732090) nescient helix loop helix 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005598 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005598 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005598 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010916 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010916 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010916 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005598 Rosetta Predictions human pricing
NM_001105970 Rosetta Predictions rat pricing
NM_010916 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005598 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00173985 predicted 987
2 SASI_Hs01_00173976 predicted 1331
3 SASI_Hs01_00173977 predicted 1218
4 SASI_Hs01_00173978 predicted 925
5 SASI_Hs01_00173979 predicted 1105
6 SASI_Hs01_00173980 predicted 1212
7 SASI_Hs02_00339907 predicted 1210
8 SASI_Hs01_00173984 predicted 1072
9 SASI_Hs01_00173982 predicted 1089
10 SASI_Hs01_00173983 predicted 1024
11 SASI_Hs01_00173981 predicted 1327
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105970 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00214342 predicted 1211
2 SASI_Rn02_00214343 predicted 1000
3 SASI_Rn02_00214344 predicted 1378
4 SASI_Rn02_00214345 predicted 1148
5 SASI_Rn02_00214346 predicted 1254
6 SASI_Rn02_00214347 predicted 633
7 SASI_Rn02_00214348 predicted 612
8 SASI_Rn02_00214349 predicted 1094
9 SASI_Rn02_00214350 predicted 1045
10 SASI_Rn02_00214351 predicted 497
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010916 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00319652 predicted 941
2 SASI_Mm01_00060037 predicted 1032
3 SASI_Mm01_00060038 predicted 736
4 SASI_Mm01_00060039 predicted 857
5 SASI_Mm01_00060040 predicted 1007
6 SASI_Mm01_00060042 predicted 808
7 SASI_Mm01_00060036 predicted 1046
8 SASI_Mm01_00060043 predicted 626
9 SASI_Mm01_00060044 predicted 1224
10 SASI_Mm01_00060045 predicted 1251
11 SASI_Mm01_00060041 predicted 1063
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005598
NHLH1 MISSION shRNA Bacterial Glycerol Stock
nescient helix loop helix 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000015024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005598.2-792s1c1
Sequence:CCGGCTGCTATATCTCCTACCTGAACTCGAGTTCAGGTAGGAGATATAGCAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015023    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005598.2-1766s1c1
Sequence:CCGGGCCCAATTGTTGCCCTCTAAACTCGAGTTTAGAGGGCAACAATTGGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005598.2-477s1c1
Sequence:CCGGCTCAGAGACTGAGTCGGGCTTCTCGAGAAGCCCGACTCAGTCTCTGAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005598.2-675s1c1
Sequence:CCGGGCGAGAACGCATCCGCGTGGACTCGAGTCCACGCGGATGCGTTCTCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005598.2-585s1c1
Sequence:CCGGGCCTGGCCGGAAAGACCTGCACTCGAGTGCAGGTCTTTCCGGCCAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427822    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005598.3-780s21c1
Sequence:CCGGAGATTGAGATTCTGCGCCTGGCTCGAGCCAGGCGCAGAATCTCAATCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413691    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005598.3-837s21c1
Sequence:CCGGACGTCTGAACTCAGCCTGTCTCTCGAGAGACAGGCTGAGTTCAGACGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426892    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005598.3-890s21c1
Sequence:CCGGCACCGCTCACTGCTTAGAAAGCTCGAGCTTTCTAAGCAGTGAGCGGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005598
NHLH1 MISSION shRNA shRNA Plasmid DNA
nescient helix loop helix 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000015024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005598.2-792s1c1
Sequence:CCGGCTGCTATATCTCCTACCTGAACTCGAGTTCAGGTAGGAGATATAGCAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015023    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005598.2-1766s1c1
Sequence:CCGGGCCCAATTGTTGCCCTCTAAACTCGAGTTTAGAGGGCAACAATTGGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005598.2-477s1c1
Sequence:CCGGCTCAGAGACTGAGTCGGGCTTCTCGAGAAGCCCGACTCAGTCTCTGAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005598.2-675s1c1
Sequence:CCGGGCGAGAACGCATCCGCGTGGACTCGAGTCCACGCGGATGCGTTCTCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005598.2-585s1c1
Sequence:CCGGGCCTGGCCGGAAAGACCTGCACTCGAGTGCAGGTCTTTCCGGCCAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427822    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005598.3-780s21c1
Sequence:CCGGAGATTGAGATTCTGCGCCTGGCTCGAGCCAGGCGCAGAATCTCAATCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413691    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005598.3-837s21c1
Sequence:CCGGACGTCTGAACTCAGCCTGTCTCTCGAGAGACAGGCTGAGTTCAGACGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426892    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005598.3-890s21c1
Sequence:CCGGCACCGCTCACTGCTTAGAAAGCTCGAGCTTTCTAAGCAGTGAGCGGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005598
NHLH1 MISSION shRNA Lentiviral Transduction Particles
nescient helix loop helix 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000015024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005598.2-792s1c1
Sequence:CCGGCTGCTATATCTCCTACCTGAACTCGAGTTCAGGTAGGAGATATAGCAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015023    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005598.2-1766s1c1
Sequence:CCGGGCCCAATTGTTGCCCTCTAAACTCGAGTTTAGAGGGCAACAATTGGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005598.2-477s1c1
Sequence:CCGGCTCAGAGACTGAGTCGGGCTTCTCGAGAAGCCCGACTCAGTCTCTGAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005598.2-675s1c1
Sequence:CCGGGCGAGAACGCATCCGCGTGGACTCGAGTCCACGCGGATGCGTTCTCGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005598.2-585s1c1
Sequence:CCGGGCCTGGCCGGAAAGACCTGCACTCGAGTGCAGGTCTTTCCGGCCAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427822    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005598.3-780s21c1
Sequence:CCGGAGATTGAGATTCTGCGCCTGGCTCGAGCCAGGCGCAGAATCTCAATCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413691    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005598.3-837s21c1
Sequence:CCGGACGTCTGAACTCAGCCTGTCTCTCGAGAGACAGGCTGAGTTCAGACGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426892    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005598.3-890s21c1
Sequence:CCGGCACCGCTCACTGCTTAGAAAGCTCGAGCTTTCTAAGCAGTGAGCGGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010916
NHLH1 MISSION shRNA Bacterial Glycerol Stock
nescient helix loop helix 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000084599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010916.1-779s1c1
Sequence:CCGGGCTCTCTAAGATTGAGATCCTCTCGAGAGGATCTCAATCTTAGAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084598    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010916.1-1855s1c1
Sequence:CCGGCCAGAGTCTATGGGCCTTAAACTCGAGTTTAAGGCCCATAGACTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010916.1-623s1c1
Sequence:CCGGGCAGCACTTGAGTCGTGAGGACTCGAGTCCTCACGACTCAAGTGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010916.1-499s1c1
Sequence:CCGGCGGAGACCGAGTCGGGCTTTACTCGAGTAAAGCCCGACTCGGTCTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010916.1-708s1c1
Sequence:CCGGCGCGTGGAAGCCTTCAACCTACTCGAGTAGGTTGAAGGCTTCCACGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010916
NHLH1 MISSION shRNA shRNA Plasmid DNA
nescient helix loop helix 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000084599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010916.1-779s1c1
Sequence:CCGGGCTCTCTAAGATTGAGATCCTCTCGAGAGGATCTCAATCTTAGAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084598    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010916.1-1855s1c1
Sequence:CCGGCCAGAGTCTATGGGCCTTAAACTCGAGTTTAAGGCCCATAGACTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010916.1-623s1c1
Sequence:CCGGGCAGCACTTGAGTCGTGAGGACTCGAGTCCTCACGACTCAAGTGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010916.1-499s1c1
Sequence:CCGGCGGAGACCGAGTCGGGCTTTACTCGAGTAAAGCCCGACTCGGTCTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010916.1-708s1c1
Sequence:CCGGCGCGTGGAAGCCTTCAACCTACTCGAGTAGGTTGAAGGCTTCCACGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010916
NHLH1 MISSION shRNA Lentiviral Transduction Particles
nescient helix loop helix 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000084599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010916.1-779s1c1
Sequence:CCGGGCTCTCTAAGATTGAGATCCTCTCGAGAGGATCTCAATCTTAGAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084598    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010916.1-1855s1c1
Sequence:CCGGCCAGAGTCTATGGGCCTTAAACTCGAGTTTAAGGCCCATAGACTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010916.1-623s1c1
Sequence:CCGGGCAGCACTTGAGTCGTGAGGACTCGAGTCCTCACGACTCAAGTGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010916.1-499s1c1
Sequence:CCGGCGGAGACCGAGTCGGGCTTTACTCGAGTAAAGCCCGACTCGGTCTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010916.1-708s1c1
Sequence:CCGGCGCGTGGAAGCCTTCAACCTACTCGAGTAGGTTGAAGGCTTCCACGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)