EMAIL THIS PAGE TO A FRIEND

NHLH2

nescient helix loop helix 2

161 Gene Product Result for
Synonyms: HEN2 NSCL2 bHLHa34
UniProtKB ID: Q02577, Q5T1P6
Gene ID:
Mouse(18072) nescient helix loop helix 2
Rat(295327) nescient helix loop helix 2
domestic guinea pig(100723052) nescient helix loop helix 2
naked mole-rat(101716777) nescient helix loop helix 2
Zebrafish(402968) nescient helix loop helix 2
cow(525699) nescient helix loop helix 2
chicken(395578) nescient helix loop helix 2
dog(483135) nescient helix loop helix 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178777 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178777 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178777 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005599 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005599 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005599 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001111061 Rosetta Predictions human pricing
NM_005599 Rosetta Predictions human pricing
NM_001106457 Rosetta Predictions rat pricing
NM_178777 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001111061 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00325206 predicted 1377
2 SASI_Hs02_00325207 predicted 1235
3 SASI_Hs02_00325208 predicted 1261
4 SASI_Hs02_00325209 predicted 1392
5 SASI_Hs02_00325210 predicted 1295
6 SASI_Hs02_00325211 predicted 1243
7 SASI_Hs02_00325212 predicted 1310
8 SASI_Hs02_00325213 predicted 1380
9 SASI_Hs02_00325214 predicted 1240
10 SASI_Hs02_00325215 predicted 1376
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005599 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00238786 predicted 1388
2 SASI_Hs01_00238787 predicted 1238
3 SASI_Hs01_00238788 predicted 1274
4 SASI_Hs01_00238790 predicted 1399
5 SASI_Hs01_00238791 predicted 1308
6 SASI_Hs01_00238793 predicted 1250
7 SASI_Hs02_00339908 predicted 1323
8 SASI_Hs02_00339909 predicted 1394
9 SASI_Hs02_00339910 predicted 1254
10 SASI_Hs02_00339911 predicted 1392
11 SASI_Hs01_00238785 predicted 1270
12 SASI_Hs01_00238789 predicted 696
13 SASI_Hs01_00238792 predicted 681
14 SASI_Hs01_00238794 predicted 1275
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106457 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00219148 predicted 2421
2 SASI_Rn02_00219149 predicted 2904
3 SASI_Rn02_00219150 predicted 2897
4 SASI_Rn02_00219151 predicted 2887
5 SASI_Rn02_00219152 predicted 2799
6 SASI_Rn02_00219153 predicted 2917
7 SASI_Rn02_00219154 predicted 2155
8 SASI_Rn02_00219155 predicted 2255
9 SASI_Rn02_00219156 predicted 2739
10 SASI_Rn02_00219157 predicted 2872
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178777 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00053481 predicted 2436
2 SASI_Mm02_00349357 predicted 2464
3 SASI_Mm01_00053482 predicted 2722
4 SASI_Mm01_00053483 predicted 2593
5 SASI_Mm01_00053484 predicted 2546
6 SASI_Mm01_00053485 predicted 2521
7 SASI_Mm01_00053486 predicted 2150
8 SASI_Mm01_00053487 predicted 2424
9 SASI_Mm01_00053488 predicted 2559
10 SASI_Mm01_00053489 predicted 2575
11 SASI_Mm01_00053480 predicted 2610
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178777
NHLH2 MISSION shRNA Bacterial Glycerol Stock
nescient helix loop helix 2
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000433356    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178777.3-1028s21c1
Sequence:CCGGAGCTTTGCAGCCTGTTCTTTCCTCGAGGAAAGAACAGGCTGCAAAGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419107    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178777.3-906s21c1
Sequence:CCGGATGTCCTGGACGTGTAGGGAGCTCGAGCTCCCTACACGTCCAGGACATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424496    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178777.3-883s21c1
Sequence:CCGGCTGCTACATCTCCTATCTCAACTCGAGTTGAGATAGGAGATGTAGCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084658    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178777.2-3257s1c1
Sequence:CCGGCCCGTCTATTTGTGACCTTAACTCGAGTTAAGGTCACAAATAGACGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178777.2-2351s1c1
Sequence:CCGGGCATCCGAGTGGAGGCTTTCACTCGAGTGAAAGCCTCCACTCGGATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084659    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178777.2-2433s1c1
Sequence:CCGGCAAGATCGAGATTCTGCGCTTCTCGAGAAGCGCAGAATCTCGATCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084660    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178777.2-2166s1c1
Sequence:CCGGCGGCGCAGACACCAAGGTTCTCTCGAGAGAACCTTGGTGTCTGCGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178777.2-2391s1c1
Sequence:CCGGCCGCAAACTACTACCCACGCTCTCGAGAGCGTGGGTAGTAGTTTGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178777
NHLH2 MISSION shRNA shRNA Plasmid DNA
nescient helix loop helix 2
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000433356    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178777.3-1028s21c1
Sequence:CCGGAGCTTTGCAGCCTGTTCTTTCCTCGAGGAAAGAACAGGCTGCAAAGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419107    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178777.3-906s21c1
Sequence:CCGGATGTCCTGGACGTGTAGGGAGCTCGAGCTCCCTACACGTCCAGGACATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424496    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178777.3-883s21c1
Sequence:CCGGCTGCTACATCTCCTATCTCAACTCGAGTTGAGATAGGAGATGTAGCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084658    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178777.2-3257s1c1
Sequence:CCGGCCCGTCTATTTGTGACCTTAACTCGAGTTAAGGTCACAAATAGACGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178777.2-2351s1c1
Sequence:CCGGGCATCCGAGTGGAGGCTTTCACTCGAGTGAAAGCCTCCACTCGGATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084659    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178777.2-2433s1c1
Sequence:CCGGCAAGATCGAGATTCTGCGCTTCTCGAGAAGCGCAGAATCTCGATCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084660    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178777.2-2166s1c1
Sequence:CCGGCGGCGCAGACACCAAGGTTCTCTCGAGAGAACCTTGGTGTCTGCGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178777.2-2391s1c1
Sequence:CCGGCCGCAAACTACTACCCACGCTCTCGAGAGCGTGGGTAGTAGTTTGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178777
NHLH2 MISSION shRNA Lentiviral Transduction Particles
nescient helix loop helix 2
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000433356    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178777.3-1028s21c1
Sequence:CCGGAGCTTTGCAGCCTGTTCTTTCCTCGAGGAAAGAACAGGCTGCAAAGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419107    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178777.3-906s21c1
Sequence:CCGGATGTCCTGGACGTGTAGGGAGCTCGAGCTCCCTACACGTCCAGGACATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424496    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178777.3-883s21c1
Sequence:CCGGCTGCTACATCTCCTATCTCAACTCGAGTTGAGATAGGAGATGTAGCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084658    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178777.2-3257s1c1
Sequence:CCGGCCCGTCTATTTGTGACCTTAACTCGAGTTAAGGTCACAAATAGACGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178777.2-2351s1c1
Sequence:CCGGGCATCCGAGTGGAGGCTTTCACTCGAGTGAAAGCCTCCACTCGGATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084659    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178777.2-2433s1c1
Sequence:CCGGCAAGATCGAGATTCTGCGCTTCTCGAGAAGCGCAGAATCTCGATCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084660    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178777.2-2166s1c1
Sequence:CCGGCGGCGCAGACACCAAGGTTCTCTCGAGAGAACCTTGGTGTCTGCGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178777.2-2391s1c1
Sequence:CCGGCCGCAAACTACTACCCACGCTCTCGAGAGCGTGGGTAGTAGTTTGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005599
NHLH2 MISSION shRNA Bacterial Glycerol Stock
nescient helix loop helix 2
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000421568    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005599.3-1247s21c1
Sequence:CCGGACTTTGAGTTCTCCTACATTCCTCGAGGAATGTAGGAGAACTCAAAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424019    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005599.3-1313s21c1
Sequence:CCGGCAGAGTATGCAGGCTCATAACCTCGAGGTTATGAGCCTGCATACTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015053    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005599.2-2162s1c1
Sequence:CCGGCGTGTGATGAATTTAGCAAATCTCGAGATTTGCTAAATTCATCACACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005599.2-884s1c1
Sequence:CCGGCTGCTACATCTCCTATCTCAACTCGAGTTGAGATAGGAGATGTAGCAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005599.2-590s1c1
Sequence:CCGGCGGCACGGACACCAAGGTGCTCTCGAGAGCACCTTGGTGTCCGTGCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005599.2-879s1c1
Sequence:CCGGGCCATCTGCTACATCTCCTATCTCGAGATAGGAGATGTAGCAGATGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005599.2-815s1c1
Sequence:CCGGCCGCAAATTGCTGCCCACGCTCTCGAGAGCGTGGGCAGCAATTTGCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005599
NHLH2 MISSION shRNA shRNA Plasmid DNA
nescient helix loop helix 2
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000421568    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005599.3-1247s21c1
Sequence:CCGGACTTTGAGTTCTCCTACATTCCTCGAGGAATGTAGGAGAACTCAAAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424019    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005599.3-1313s21c1
Sequence:CCGGCAGAGTATGCAGGCTCATAACCTCGAGGTTATGAGCCTGCATACTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015053    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005599.2-2162s1c1
Sequence:CCGGCGTGTGATGAATTTAGCAAATCTCGAGATTTGCTAAATTCATCACACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005599.2-884s1c1
Sequence:CCGGCTGCTACATCTCCTATCTCAACTCGAGTTGAGATAGGAGATGTAGCAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005599.2-590s1c1
Sequence:CCGGCGGCACGGACACCAAGGTGCTCTCGAGAGCACCTTGGTGTCCGTGCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005599.2-879s1c1
Sequence:CCGGGCCATCTGCTACATCTCCTATCTCGAGATAGGAGATGTAGCAGATGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005599.2-815s1c1
Sequence:CCGGCCGCAAATTGCTGCCCACGCTCTCGAGAGCGTGGGCAGCAATTTGCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005599
NHLH2 MISSION shRNA Lentiviral Transduction Particles
nescient helix loop helix 2
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000421568    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005599.3-1247s21c1
Sequence:CCGGACTTTGAGTTCTCCTACATTCCTCGAGGAATGTAGGAGAACTCAAAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424019    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005599.3-1313s21c1
Sequence:CCGGCAGAGTATGCAGGCTCATAACCTCGAGGTTATGAGCCTGCATACTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015053    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005599.2-2162s1c1
Sequence:CCGGCGTGTGATGAATTTAGCAAATCTCGAGATTTGCTAAATTCATCACACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005599.2-884s1c1
Sequence:CCGGCTGCTACATCTCCTATCTCAACTCGAGTTGAGATAGGAGATGTAGCAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005599.2-590s1c1
Sequence:CCGGCGGCACGGACACCAAGGTGCTCTCGAGAGCACCTTGGTGTCCGTGCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005599.2-879s1c1
Sequence:CCGGGCCATCTGCTACATCTCCTATCTCGAGATAGGAGATGTAGCAGATGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005599.2-815s1c1
Sequence:CCGGCCGCAAATTGCTGCCCACGCTCTCGAGAGCGTGGGCAGCAATTTGCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)