EMAIL THIS PAGE TO A FRIEND

NHLRC1

NHL repeat containing 1

125 Gene Product Result for
Synonyms: EPM2A EPM2B MALIN bA204B7.2
UniProtKB ID: Q6VVB1, Q3SYB1, Q5VUK7, Q6IMH1
Gene ID:
Human(378884) Summary: The protein encoded by this gene is a single subunit E3 ubiquitin ligase. Laforin is polyubiquitinated by the encoded protein. Defects in this intronless gene lead to an accumulation of laforin and onset of Lafora disease, also known as progressive myoclonic epilepsy type 2 (EPM2).[provided by RefSeq, Mar 2010]
Mouse(105193) NHL repeat containing 1
Rat(364682) NHL repeat containing 1
chicken(428477) NHL repeat containing 1
domestic cat(101099882) NHL repeat containing 1
cow(538814) NHL repeat containing 1
Horse(100066209) NHL repeat containing 1
dog(474161) NHL repeat containing 1
sheep(101111754) NHL repeat containing 1
domestic guinea pig(100731006) NHL repeat containing 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4301722 Anti-NHLRC1 affinity isolated antibody human
western blot pricing
SAB1303961 ANTI-NHLRC1 (CENTER) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB5201167 Monoclonal Anti-Malin - Alkaline Phosphatase antibody produced in mouse clone S85-18, purified immunoglobulin human
immunocytochemistry, western blot pricing
SAB5201168 Monoclonal Anti-Malin - Apc antibody produced in mouse clone S85-18, purified immunoglobulin human
immunocytochemistry, western blot pricing
SAB5201159 Monoclonal Anti-Malin - Atto 390 antibody produced in mouse clone S85-18, purified immunoglobulin human
immunocytochemistry, western blot pricing
SAB5201160 Monoclonal Anti-Malin - Atto 488 antibody produced in mouse clone S85-18, purified immunoglobulin human
immunocytochemistry, western blot pricing
SAB5201161 Monoclonal Anti-Malin - Atto 565 antibody produced in mouse clone S85-18, purified immunoglobulin human
immunocytochemistry, western blot pricing
SAB5201162 Monoclonal Anti-Malin - Atto 594 antibody produced in mouse clone S85-18, purified immunoglobulin human
immunocytochemistry, western blot pricing
SAB5201163 Monoclonal Anti-Malin - Atto 633 antibody produced in mouse clone S85-18, purified immunoglobulin human
immunocytochemistry, western blot pricing
SAB5201164 Monoclonal Anti-Malin - Atto 655 antibody produced in mouse clone S85-18, purified immunoglobulin human
immunocytochemistry, western blot pricing
SAB5201165 Monoclonal Anti-Malin - Atto 680 antibody produced in mouse clone S85-18, purified immunoglobulin human
immunocytochemistry, western blot pricing
SAB5201166 Monoclonal Anti-Malin - Atto 700 antibody produced in mouse clone S85-18, purified immunoglobulin human
immunocytochemistry, western blot pricing
SAB5201169 Monoclonal Anti-Malin - Biotin antibody produced in mouse clone S85-18, purified immunoglobulin human
immunocytochemistry, western blot pricing
SAB5201170 Monoclonal Anti-Malin - Fitc antibody produced in mouse clone S85-18, purified immunoglobulin human
immunocytochemistry, western blot pricing
SAB5201171 Monoclonal Anti-Malin - Hrp antibody produced in mouse clone S85-18, purified immunoglobulin human
immunocytochemistry, western blot pricing
SAB5201172 Monoclonal Anti-Malin - Pe/Atto 594 antibody produced in mouse clone S85-18, purified immunoglobulin human
immunocytochemistry, western blot pricing
SAB5201173 Monoclonal Anti-Malin - Percp antibody produced in mouse clone S85-18, purified immunoglobulin human
immunocytochemistry, western blot pricing
SAB5201174 Monoclonal Anti-Malin - Rpe antibody produced in mouse clone S85-18, purified immunoglobulin human
immunocytochemistry, western blot pricing
SAB5201175 Monoclonal Anti-Malin - Streptavidin antibody produced in mouse clone S85-18, purified immunoglobulin human
immunocytochemistry, western blot pricing
SAB5201158 Monoclonal Anti-Malin antibody produced in mouse clone S85-18, purified immunoglobulin human
immunocytochemistry, western blot pricing
SAB1403502 Monoclonal Anti-NHLRC1 antibody produced in mouse clone 3G6, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_198586 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_198586 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_198586 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_175340 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175340 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175340 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU056031 MISSION® esiRNA esiRNA human NHLRC1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_198586 Rosetta Predictions human pricing
NM_199236 Rosetta Predictions rat pricing
NM_175340 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198586 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00174716 predicted 892
2 SASI_Hs01_00174718 predicted 644
3 SASI_Hs01_00174719 predicted 936
4 SASI_Hs01_00174720 predicted 559
5 SASI_Hs01_00174722 predicted 684
6 SASI_Hs02_00372236 predicted 569
7 SASI_Hs01_00174723 predicted 909
8 SASI_Hs01_00174724 predicted 561
9 SASI_Hs01_00174725 predicted 685
10 SASI_Hs02_00372237 predicted 768
11 SASI_Hs01_00174717 predicted 757
12 SASI_Hs01_00174721 predicted 954
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199236 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00119086 predicted 535
2 SASI_Rn01_00119087 predicted 427
3 SASI_Rn01_00119088 predicted 749
4 SASI_Rn01_00119089 predicted 569
5 SASI_Rn01_00119090 predicted 888
6 SASI_Rn01_00119091 predicted 217
7 SASI_Rn01_00119092 predicted 580
8 SASI_Rn01_00119093 predicted 738
9 SASI_Rn01_00119094 predicted 960
10 SASI_Rn01_00119095 predicted 852
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175340 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00125529 predicted 1044
2 SASI_Mm01_00125530 predicted 1455
3 SASI_Mm01_00125531 predicted 942
4 SASI_Mm01_00125532 predicted 1184
5 SASI_Mm01_00125533 predicted 1180
6 SASI_Mm01_00125534 predicted 1315
7 SASI_Mm01_00125535 predicted 1519
8 SASI_Mm01_00125536 predicted 1034
9 SASI_Mm01_00125537 predicted 956
10 SASI_Mm01_00125538 predicted 1440
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198586
VALIDATED
NHLRC1 MISSION shRNA Bacterial Glycerol Stock
NHL repeat containing 1
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000034184    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_198586.2-601s1c1
Sequence:CCGGGCTCCATCAAAGTGTTTGATTCTCGAGAATCAAACACTTTGATGGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034185    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198586.2-764s1c1
Sequence:CCGGCCTTCGGAGAACTGAAAGGTTCTCGAGAACCTTTCAGTTCTCCGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034186    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198586.2-1084s1c1
Sequence:CCGGCCATGGTCACTCATGGTCTTTCTCGAGAAAGACCATGAGTGACCATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198586.2-494s1c1
Sequence:CCGGCGCGCATCAGTTTGGAGAGAACTCGAGTTCTCTCCAAACTGATGCGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034187    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198586.2-951s1c1
Sequence:CCGGAGCCTCTACTTTCCCTCCAAACTCGAGTTTGGAGGGAAAGTAGAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365098    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198586.2-1155s21c1
Sequence:CCGGGACACAGCATCTCATTCTATACTCGAGTATAGAATGAGATGCTGTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000377450    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198586.2-638s21c1
Sequence:CCGGGCTTGTCATTGGAGGCCAATTCTCGAGAATTGGCCTCCAATGACAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376550    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198586.2-886s21c1
Sequence:CCGGGCACCAGGGTGAAAGTGTTTACTCGAGTAAACACTTTCACCCTGGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370097    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198586.2-925s21c1
Sequence:CCGGTCGGCCAAGTGGATACCTTTGCTCGAGCAAAGGTATCCACTTGGCCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365097    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198586.2-598s21c1
Sequence:CCGGATCGCTCCATCAAAGTGTTTGCTCGAGCAAACACTTTGATGGAGCGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365044    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198586.2-1421s21c1
Sequence:CCGGTACTATCCAGTGAGGTAATTTCTCGAGAAATTACCTCACTGGATAGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370098    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198586.2-1347s21c1
Sequence:CCGGTGGAGATTAATCTACCATTTACTCGAGTAAATGGTAGATTAATCTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198586
VALIDATED
NHLRC1 MISSION shRNA shRNA Plasmid DNA
NHL repeat containing 1
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000034184    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_198586.2-601s1c1
Sequence:CCGGGCTCCATCAAAGTGTTTGATTCTCGAGAATCAAACACTTTGATGGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034185    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198586.2-764s1c1
Sequence:CCGGCCTTCGGAGAACTGAAAGGTTCTCGAGAACCTTTCAGTTCTCCGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034186    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198586.2-1084s1c1
Sequence:CCGGCCATGGTCACTCATGGTCTTTCTCGAGAAAGACCATGAGTGACCATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198586.2-494s1c1
Sequence:CCGGCGCGCATCAGTTTGGAGAGAACTCGAGTTCTCTCCAAACTGATGCGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034187    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198586.2-951s1c1
Sequence:CCGGAGCCTCTACTTTCCCTCCAAACTCGAGTTTGGAGGGAAAGTAGAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365098    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198586.2-1155s21c1
Sequence:CCGGGACACAGCATCTCATTCTATACTCGAGTATAGAATGAGATGCTGTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000377450    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198586.2-638s21c1
Sequence:CCGGGCTTGTCATTGGAGGCCAATTCTCGAGAATTGGCCTCCAATGACAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000376550    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198586.2-886s21c1
Sequence:CCGGGCACCAGGGTGAAAGTGTTTACTCGAGTAAACACTTTCACCCTGGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000370097    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198586.2-925s21c1
Sequence:CCGGTCGGCCAAGTGGATACCTTTGCTCGAGCAAAGGTATCCACTTGGCCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365097    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198586.2-598s21c1
Sequence:CCGGATCGCTCCATCAAAGTGTTTGCTCGAGCAAACACTTTGATGGAGCGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365044    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198586.2-1421s21c1
Sequence:CCGGTACTATCCAGTGAGGTAATTTCTCGAGAAATTACCTCACTGGATAGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000370098    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198586.2-1347s21c1
Sequence:CCGGTGGAGATTAATCTACCATTTACTCGAGTAAATGGTAGATTAATCTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198586
VALIDATED
NHLRC1 MISSION shRNA Lentiviral Transduction Particles
NHL repeat containing 1
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000034184    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_198586.2-601s1c1
Sequence:CCGGGCTCCATCAAAGTGTTTGATTCTCGAGAATCAAACACTTTGATGGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034185    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198586.2-764s1c1
Sequence:CCGGCCTTCGGAGAACTGAAAGGTTCTCGAGAACCTTTCAGTTCTCCGAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034186    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198586.2-1084s1c1
Sequence:CCGGCCATGGTCACTCATGGTCTTTCTCGAGAAAGACCATGAGTGACCATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198586.2-494s1c1
Sequence:CCGGCGCGCATCAGTTTGGAGAGAACTCGAGTTCTCTCCAAACTGATGCGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034187    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198586.2-951s1c1
Sequence:CCGGAGCCTCTACTTTCCCTCCAAACTCGAGTTTGGAGGGAAAGTAGAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365098    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198586.2-1155s21c1
Sequence:CCGGGACACAGCATCTCATTCTATACTCGAGTATAGAATGAGATGCTGTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000377450    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198586.2-638s21c1
Sequence:CCGGGCTTGTCATTGGAGGCCAATTCTCGAGAATTGGCCTCCAATGACAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376550    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198586.2-886s21c1
Sequence:CCGGGCACCAGGGTGAAAGTGTTTACTCGAGTAAACACTTTCACCCTGGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370097    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198586.2-925s21c1
Sequence:CCGGTCGGCCAAGTGGATACCTTTGCTCGAGCAAAGGTATCCACTTGGCCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365097    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198586.2-598s21c1
Sequence:CCGGATCGCTCCATCAAAGTGTTTGCTCGAGCAAACACTTTGATGGAGCGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365044    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198586.2-1421s21c1
Sequence:CCGGTACTATCCAGTGAGGTAATTTCTCGAGAAATTACCTCACTGGATAGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370098    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198586.2-1347s21c1
Sequence:CCGGTGGAGATTAATCTACCATTTACTCGAGTAAATGGTAGATTAATCTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175340
NHLRC1 MISSION shRNA Bacterial Glycerol Stock
NHL repeat containing 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000125479    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175340.2-2039s1c1
Sequence:CCGGCCGCAGTGATAATTTGAGAAACTCGAGTTTCTCAAATTATCACTGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175340.2-1033s1c1
Sequence:CCGGGATCACCAAGGAAACGTGATTCTCGAGAATCACGTTTCCTTGGTGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175340.2-635s1c1
Sequence:CCGGGCTCCCTCAAAGTGTTTGATTCTCGAGAATCAAACACTTTGAGGGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125483    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175340.2-1036s1c1
Sequence:CCGGCACCAAGGAAACGTGATTGTTCTCGAGAACAATCACGTTTCCTTGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175340.2-933s1c1
Sequence:CCGGGAAGGTGTTCAACTCCACTATCTCGAGATAGTGGAGTTGAACACCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175340
NHLRC1 MISSION shRNA shRNA Plasmid DNA
NHL repeat containing 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000125479    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175340.2-2039s1c1
Sequence:CCGGCCGCAGTGATAATTTGAGAAACTCGAGTTTCTCAAATTATCACTGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175340.2-1033s1c1
Sequence:CCGGGATCACCAAGGAAACGTGATTCTCGAGAATCACGTTTCCTTGGTGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175340.2-635s1c1
Sequence:CCGGGCTCCCTCAAAGTGTTTGATTCTCGAGAATCAAACACTTTGAGGGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125483    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175340.2-1036s1c1
Sequence:CCGGCACCAAGGAAACGTGATTGTTCTCGAGAACAATCACGTTTCCTTGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175340.2-933s1c1
Sequence:CCGGGAAGGTGTTCAACTCCACTATCTCGAGATAGTGGAGTTGAACACCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175340
NHLRC1 MISSION shRNA Lentiviral Transduction Particles
NHL repeat containing 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000125479    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175340.2-2039s1c1
Sequence:CCGGCCGCAGTGATAATTTGAGAAACTCGAGTTTCTCAAATTATCACTGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175340.2-1033s1c1
Sequence:CCGGGATCACCAAGGAAACGTGATTCTCGAGAATCACGTTTCCTTGGTGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175340.2-635s1c1
Sequence:CCGGGCTCCCTCAAAGTGTTTGATTCTCGAGAATCAAACACTTTGAGGGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125483    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175340.2-1036s1c1
Sequence:CCGGCACCAAGGAAACGTGATTGTTCTCGAGAACAATCACGTTTCCTTGGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175340.2-933s1c1
Sequence:CCGGGAAGGTGTTCAACTCCACTATCTCGAGATAGTGGAGTTGAACACCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)