EMAIL THIS PAGE TO A FRIEND

NHLRC3

NHL repeat containing 3

65 Gene Product Result for
UniProtKB ID: Q5JS37, B2RTZ2, B4DTL0, Q69YI9
Gene ID:
Human(387921) Summary: This gene encodes a protein containing NCL-1, HT2A and Lin-41 (NHL) family repeats. Mammalian NHL-repeat containing proteins may be involved in a variety of enzymatic processes, including protein modification through ubiquitination. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Aug 2012]
Mouse(212114) NHL repeat containing 3
Rat(310416) NHL repeat containing 3
chicken(418890) NHL repeat containing 3
cow(506625) NHL repeat containing 3
domestic cat(101087804) NHL repeat containing 3
dog(485999) NHL repeat containing 3
sheep(101123051) NHL repeat containing 3
naked mole-rat(101715253) NHL repeat containing 3
domestic guinea pig(100719817) NHL repeat containing 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001012754 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001012754 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001012754 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172501 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172501 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172501 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001012754 Rosetta Predictions human pricing
NM_001017370 Rosetta Predictions human pricing
XM_001054658 Rosetta Predictions rat pricing
XM_227139 Rosetta Predictions rat pricing
NM_172501 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012754 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00064770 predicted 1249
2 SASI_Hs01_00064771 predicted 476
3 SASI_Hs01_00064772 predicted 1374
4 SASI_Hs01_00064773 predicted 1106
5 SASI_Hs02_00306242 predicted 424
6 SASI_Hs01_00064775 predicted 326
7 SASI_Hs01_00064776 predicted 1220
8 SASI_Hs02_00306243 predicted 1279
9 SASI_Hs01_00064778 predicted 1269
10 SASI_Hs01_00064779 predicted 454
11 SASI_Hs01_00064774 predicted 1440
12 SASI_Hs01_00064777 predicted 1141
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001017370 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00051927 predicted 1048
2 SASI_Hs01_00051928 predicted 474
3 SASI_Hs01_00051929 predicted 1173
4 SASI_Hs01_00051930 predicted 909
5 SASI_Hs02_00306708 predicted 424
6 SASI_Hs01_00051932 predicted 323
7 SASI_Hs01_00051933 predicted 1023
8 SASI_Hs02_00306709 predicted 1081
9 SASI_Hs01_00051935 predicted 1065
10 SASI_Hs01_00051936 predicted 454
11 SASI_Hs01_00051931 predicted 1237
12 SASI_Hs01_00051934 predicted 934
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001054658 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00276667 predicted 635
2 SASI_Rn02_00276668 predicted 571
3 SASI_Rn02_00276669 predicted 738
4 SASI_Rn02_00276670 predicted 936
5 SASI_Rn02_00276671 predicted 296
6 SASI_Rn02_00276672 predicted 1017
7 SASI_Rn02_00276673 predicted 1177
8 SASI_Rn02_00276674 predicted 257
9 SASI_Rn02_00276675 predicted 210
10 SASI_Rn02_00276676 predicted 435
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_227139 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00384107 predicted 629
2 SASI_Rn02_00384108 predicted 571
3 SASI_Rn02_00384109 predicted 737
4 SASI_Rn02_00384110 predicted 943
5 SASI_Rn02_00384111 predicted 290
6 SASI_Rn02_00384112 predicted 1017
7 SASI_Rn02_00384113 predicted 1181
8 SASI_Rn02_00384114 predicted 262
9 SASI_Rn02_00384115 predicted 211
10 SASI_Rn02_00384116 predicted 431
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172501 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00145475 predicted 667
2 SASI_Mm01_00145476 predicted 806
3 SASI_Mm01_00145477 predicted 269
4 SASI_Mm01_00145478 predicted 946
5 SASI_Mm01_00145479 predicted 1232
6 SASI_Mm01_00145480 predicted 1059
7 SASI_Mm01_00145481 predicted 745
8 SASI_Mm01_00145482 predicted 283
9 SASI_Mm01_00145483 predicted 1022
10 SASI_Mm01_00145484 predicted 373
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001012754
VALIDATED
NHLRC3 MISSION shRNA Bacterial Glycerol Stock
NHL repeat containing 3
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000165385    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_001012754.1-2732s1c1
Sequence:CCGGCCGTGAGGTTAGGAAGGTAAACTCGAGTTTACCTTCCTAACCTCACGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160716    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_001012754.1-968s1c1
Sequence:CCGGCCTCACAGTGTTACACTTGATCTCGAGATCAAGTGTAACACTGTGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161257    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_001012754.1-353s1c1
Sequence:CCGGGCTGGCTTCTTTCTTGCATTTCTCGAGAAATGCAAGAAAGAAGCCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159023    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_001012754.1-702s1c1
Sequence:CCGGGAAGTGGATTCTTTGGTCATACTCGAGTATGACCAAAGAATCCACTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160403    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012754.1-903s1c1
Sequence:CCGGCCCAAGATTTCATGATCCTTTCTCGAGAAAGGATCATGAAATCTTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158724    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_001012754.1-1283s1c1
Sequence:CCGGGCAGTCTATGTAGCAGAAATTCTCGAGAATTTCTGCTACATAGACTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162210    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_001012754.1-806s1c1
Sequence:CCGGCAGTTTGATAACCCAGCAGAACTCGAGTTCTGCTGGGTTATCAAACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159870    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_001012754.1-1341s1c1
Sequence:CCGGGCTATGTTCCTTCATTTGGTTCTCGAGAACCAAATGAAGGAACATAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159385    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_001012754.1-2981s1c1
Sequence:CCGGGCCCTTCTAAATGTGCTATTTCTCGAGAAATAGCACATTTAGAAGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012754.1-614s1c1
Sequence:CCGGCGAGCCTGGAATTATACAGTTCTCGAGAACTGTATAATTCCAGGCTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001012754
VALIDATED
NHLRC3 MISSION shRNA shRNA Plasmid DNA
NHL repeat containing 3
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000165385    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_001012754.1-2732s1c1
Sequence:CCGGCCGTGAGGTTAGGAAGGTAAACTCGAGTTTACCTTCCTAACCTCACGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160716    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_001012754.1-968s1c1
Sequence:CCGGCCTCACAGTGTTACACTTGATCTCGAGATCAAGTGTAACACTGTGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161257    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_001012754.1-353s1c1
Sequence:CCGGGCTGGCTTCTTTCTTGCATTTCTCGAGAAATGCAAGAAAGAAGCCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159023    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_001012754.1-702s1c1
Sequence:CCGGGAAGTGGATTCTTTGGTCATACTCGAGTATGACCAAAGAATCCACTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160403    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012754.1-903s1c1
Sequence:CCGGCCCAAGATTTCATGATCCTTTCTCGAGAAAGGATCATGAAATCTTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158724    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_001012754.1-1283s1c1
Sequence:CCGGGCAGTCTATGTAGCAGAAATTCTCGAGAATTTCTGCTACATAGACTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162210    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_001012754.1-806s1c1
Sequence:CCGGCAGTTTGATAACCCAGCAGAACTCGAGTTCTGCTGGGTTATCAAACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159870    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_001012754.1-1341s1c1
Sequence:CCGGGCTATGTTCCTTCATTTGGTTCTCGAGAACCAAATGAAGGAACATAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159385    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_001012754.1-2981s1c1
Sequence:CCGGGCCCTTCTAAATGTGCTATTTCTCGAGAAATAGCACATTTAGAAGGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012754.1-614s1c1
Sequence:CCGGCGAGCCTGGAATTATACAGTTCTCGAGAACTGTATAATTCCAGGCTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001012754
VALIDATED
NHLRC3 MISSION shRNA Lentiviral Transduction Particles
NHL repeat containing 3
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000165385    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_001012754.1-2732s1c1
Sequence:CCGGCCGTGAGGTTAGGAAGGTAAACTCGAGTTTACCTTCCTAACCTCACGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160716    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_001012754.1-968s1c1
Sequence:CCGGCCTCACAGTGTTACACTTGATCTCGAGATCAAGTGTAACACTGTGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161257    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_001012754.1-353s1c1
Sequence:CCGGGCTGGCTTCTTTCTTGCATTTCTCGAGAAATGCAAGAAAGAAGCCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159023    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_001012754.1-702s1c1
Sequence:CCGGGAAGTGGATTCTTTGGTCATACTCGAGTATGACCAAAGAATCCACTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160403    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012754.1-903s1c1
Sequence:CCGGCCCAAGATTTCATGATCCTTTCTCGAGAAAGGATCATGAAATCTTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158724    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_001012754.1-1283s1c1
Sequence:CCGGGCAGTCTATGTAGCAGAAATTCTCGAGAATTTCTGCTACATAGACTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162210    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_001012754.1-806s1c1
Sequence:CCGGCAGTTTGATAACCCAGCAGAACTCGAGTTCTGCTGGGTTATCAAACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159870    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_001012754.1-1341s1c1
Sequence:CCGGGCTATGTTCCTTCATTTGGTTCTCGAGAACCAAATGAAGGAACATAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159385    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_001012754.1-2981s1c1
Sequence:CCGGGCCCTTCTAAATGTGCTATTTCTCGAGAAATAGCACATTTAGAAGGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012754.1-614s1c1
Sequence:CCGGCGAGCCTGGAATTATACAGTTCTCGAGAACTGTATAATTCCAGGCTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172501
NHLRC3 MISSION shRNA Bacterial Glycerol Stock
NHL repeat containing 3
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000184167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172501.1-743s1c1
Sequence:CCGGCCTGCCAAGTTCAACATACCTCTCGAGAGGTATGTTGAACTTGGCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184078    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172501.1-809s1c1
Sequence:CCGGCGAGGAAATAAGAGGCTCCAACTCGAGTTGGAGCCTCTTATTTCCTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184603    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172501.1-320s1c1
Sequence:CCGGGATTCCCTCAACGGGTTAGTTCTCGAGAACTAACCCGTTGAGGGAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180120    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172501.1-1330s1c1
Sequence:CCGGCTCATCACTTCCTAAGTGCTACTCGAGTAGCACTTAGGAAGTGATGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172501
NHLRC3 MISSION shRNA shRNA Plasmid DNA
NHL repeat containing 3
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000184167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172501.1-743s1c1
Sequence:CCGGCCTGCCAAGTTCAACATACCTCTCGAGAGGTATGTTGAACTTGGCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000184078    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172501.1-809s1c1
Sequence:CCGGCGAGGAAATAAGAGGCTCCAACTCGAGTTGGAGCCTCTTATTTCCTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000184603    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172501.1-320s1c1
Sequence:CCGGGATTCCCTCAACGGGTTAGTTCTCGAGAACTAACCCGTTGAGGGAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180120    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172501.1-1330s1c1
Sequence:CCGGCTCATCACTTCCTAAGTGCTACTCGAGTAGCACTTAGGAAGTGATGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172501
NHLRC3 MISSION shRNA Lentiviral Transduction Particles
NHL repeat containing 3
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000184167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172501.1-743s1c1
Sequence:CCGGCCTGCCAAGTTCAACATACCTCTCGAGAGGTATGTTGAACTTGGCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184078    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172501.1-809s1c1
Sequence:CCGGCGAGGAAATAAGAGGCTCCAACTCGAGTTGGAGCCTCTTATTTCCTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184603    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172501.1-320s1c1
Sequence:CCGGGATTCCCTCAACGGGTTAGTTCTCGAGAACTAACCCGTTGAGGGAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180120    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172501.1-1330s1c1
Sequence:CCGGCTCATCACTTCCTAAGTGCTACTCGAGTAGCACTTAGGAAGTGATGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)