EMAIL THIS PAGE TO A FRIEND

NHLRC4

NHL repeat containing 4

27 Gene Product Result for
UniProtKB ID: P0CG21, B8ZZ27, Q8N233, Q96AX3, Q96S23
Gene ID:
Mouse(621239) NHL repeat containing 4
Rat(100909527) NHL repeat containing 4
dog(611462) uncharacterized LOC611462
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_176677 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_176677 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_176677 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001039038 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001039038 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001039038 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_176677 Rosetta Predictions human pricing
NM_001039038 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_176677 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00032999 predicted 765
2 SASI_Hs01_00033000 predicted 769
3 SASI_Hs01_00033001 predicted 644
4 SASI_Hs01_00033002 predicted 758
5 SASI_Hs01_00033004 predicted 664
6 SASI_Hs01_00033005 predicted 1115
7 SASI_Hs01_00033006 predicted 763
8 SASI_Hs01_00033007 predicted 933
9 SASI_Hs01_00033008 predicted 1062
10 SASI_Hs02_00369207 predicted 677
11 SASI_Hs01_00033003 predicted 953
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039038 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00124822 predicted 1130
2 SASI_Mm01_00124823 predicted 1229
3 SASI_Mm01_00124824 predicted 1174
4 SASI_Mm01_00124825 predicted 882
5 SASI_Mm01_00124826 predicted 1325
6 SASI_Mm01_00124828 predicted 812
7 SASI_Mm01_00124829 predicted 1222
8 SASI_Mm01_00124830 predicted 1058
9 SASI_Mm01_00124831 predicted 714
10 SASI_Mm02_00289724 predicted 1232
11 SASI_Mm01_00124827 predicted 948
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_176677
NHLRC4 MISSION shRNA Bacterial Glycerol Stock
NHL repeat containing 4
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000180654    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_176677.1-920s1c1
Sequence:CCGGCAAGGACAACTCCATCAAGGTCTCGAGACCTTGATGGAGTTGTCCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179956    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_176677.1-764s1c1
Sequence:CCGGCAACTCAGAGGGCAATGTTATCTCGAGATAACATTGCCCTCTGAGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180030    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_176677.1-926s1c1
Sequence:CCGGCAACTCCATCAAGGTGTACCACTCGAGTGGTACACCTTGATGGAGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000282942    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176677.1-649s21c1
Sequence:CCGGTTGCTGTGAGTGAGGAGTTTGCTCGAGCAAACTCCTCACTCACAGCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264185    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176677.1-764s21c1
Sequence:CCGGCAACTCAGAGGGCAATGTTATCTCGAGATAACATTGCCCTCTGAGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264187    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176677.1-917s21c1
Sequence:CCGGTGCCAAGGACAACTCCATCAACTCGAGTTGATGGAGTTGTCCTTGGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264186    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_176677.1-1769s21c1
Sequence:CCGGTCTAACCCTCTCCTCCCATTTCTCGAGAAATGGGAGGAGAGGGTTAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_176677
NHLRC4 MISSION shRNA shRNA Plasmid DNA
NHL repeat containing 4
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000180654    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_176677.1-920s1c1
Sequence:CCGGCAAGGACAACTCCATCAAGGTCTCGAGACCTTGATGGAGTTGTCCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179956    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_176677.1-764s1c1
Sequence:CCGGCAACTCAGAGGGCAATGTTATCTCGAGATAACATTGCCCTCTGAGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180030    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_176677.1-926s1c1
Sequence:CCGGCAACTCCATCAAGGTGTACCACTCGAGTGGTACACCTTGATGGAGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000282942    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176677.1-649s21c1
Sequence:CCGGTTGCTGTGAGTGAGGAGTTTGCTCGAGCAAACTCCTCACTCACAGCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264185    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176677.1-764s21c1
Sequence:CCGGCAACTCAGAGGGCAATGTTATCTCGAGATAACATTGCCCTCTGAGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264187    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176677.1-917s21c1
Sequence:CCGGTGCCAAGGACAACTCCATCAACTCGAGTTGATGGAGTTGTCCTTGGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264186    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_176677.1-1769s21c1
Sequence:CCGGTCTAACCCTCTCCTCCCATTTCTCGAGAAATGGGAGGAGAGGGTTAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_176677
NHLRC4 MISSION shRNA Lentiviral Transduction Particles
NHL repeat containing 4
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000180654    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_176677.1-920s1c1
Sequence:CCGGCAAGGACAACTCCATCAAGGTCTCGAGACCTTGATGGAGTTGTCCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179956    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_176677.1-764s1c1
Sequence:CCGGCAACTCAGAGGGCAATGTTATCTCGAGATAACATTGCCCTCTGAGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180030    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_176677.1-926s1c1
Sequence:CCGGCAACTCCATCAAGGTGTACCACTCGAGTGGTACACCTTGATGGAGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000282942    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176677.1-649s21c1
Sequence:CCGGTTGCTGTGAGTGAGGAGTTTGCTCGAGCAAACTCCTCACTCACAGCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264185    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176677.1-764s21c1
Sequence:CCGGCAACTCAGAGGGCAATGTTATCTCGAGATAACATTGCCCTCTGAGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264187    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176677.1-917s21c1
Sequence:CCGGTGCCAAGGACAACTCCATCAACTCGAGTTGATGGAGTTGTCCTTGGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264186    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_176677.1-1769s21c1
Sequence:CCGGTCTAACCCTCTCCTCCCATTTCTCGAGAAATGGGAGGAGAGGGTTAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001039038
NHLRC4 MISSION shRNA Bacterial Glycerol Stock
NHL repeat containing 4
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000269325    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039038.2-976s21c1
Sequence:CCGGGCATCAAGTTGTACCAGTATCCTCGAGGATACTGGTACAACTTGATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000269322    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039038.2-891s21c1
Sequence:CCGGTTGCAGTTGGAGGGACTAAAGCTCGAGCTTTAGTCCCTCCAACTGCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000269324    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039038.2-761s21c1
Sequence:CCGGAGGAACCCTGACTGGGCATAACTCGAGTTATGCCCAGTCAGGGTTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000269323    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001039038.2-1225s21c1
Sequence:CCGGCATCTCCACTTCCCTATTAAGCTCGAGCTTAATAGGGAAGTGGAGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001039038
NHLRC4 MISSION shRNA shRNA Plasmid DNA
NHL repeat containing 4
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000269325    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039038.2-976s21c1
Sequence:CCGGGCATCAAGTTGTACCAGTATCCTCGAGGATACTGGTACAACTTGATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000269322    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039038.2-891s21c1
Sequence:CCGGTTGCAGTTGGAGGGACTAAAGCTCGAGCTTTAGTCCCTCCAACTGCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000269324    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039038.2-761s21c1
Sequence:CCGGAGGAACCCTGACTGGGCATAACTCGAGTTATGCCCAGTCAGGGTTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000269323    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001039038.2-1225s21c1
Sequence:CCGGCATCTCCACTTCCCTATTAAGCTCGAGCTTAATAGGGAAGTGGAGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001039038
NHLRC4 MISSION shRNA Lentiviral Transduction Particles
NHL repeat containing 4
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000269325    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039038.2-976s21c1
Sequence:CCGGGCATCAAGTTGTACCAGTATCCTCGAGGATACTGGTACAACTTGATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000269322    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039038.2-891s21c1
Sequence:CCGGTTGCAGTTGGAGGGACTAAAGCTCGAGCTTTAGTCCCTCCAACTGCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000269324    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039038.2-761s21c1
Sequence:CCGGAGGAACCCTGACTGGGCATAACTCGAGTTATGCCCAGTCAGGGTTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000269323    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001039038.2-1225s21c1
Sequence:CCGGCATCTCCACTTCCCTATTAAGCTCGAGCTTAATAGGGAAGTGGAGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)