EMAIL THIS PAGE TO A FRIEND

NHP2

NHP2 ribonucleoprotein

67 Gene Product Result for
Synonyms: DKCB2 NHP2P NOLA2
UniProtKB ID: Q9NX24, A6NKY8, Q9P095
Gene ID:
Human(55651) Summary: This gene is a member of the H/ACA snoRNPs (small nucleolar ribonucleoproteins) gene family. snoRNPs are involved in various aspects of rRNA processing and modification and have been classified into two families: C/D and H/ACA. The H/ACA snoRNPs also include the DKC1, NOLA1 and NOLA3 proteins. These four H/ACA snoRNP proteins localize to the dense fibrillar components of nucleoli and to coiled (Cajal) bodies in the nucleus. Both 18S rRNA production and rRNA pseudouridylation are impaired if any one of the four proteins is depleted. The four H/ACA snoRNP proteins are also components of the telomerase complex. This gene encodes a protein related to Saccharomyces cerevisiae Nhp2p. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2008]
Mouse(52530) NHP2 ribonucleoprotein
Rat(287273) NHP2 ribonucleoprotein
fruit fly(44005) CG5258 gene product from transcript CG5258-RB
Zebrafish(100003787) NHP2 ribonucleoprotein homolog (yeast)
cow(520891) NHP2 ribonucleoprotein homolog (yeast)
domestic cat(101088136) NHP2 ribonucleoprotein homolog (yeast)
dog(474644) NHP2 ribonucleoprotein homolog (yeast)
chicken(416218) NHP2 ribonucleoprotein homolog (yeast)
sheep(101103564) NHP2 ribonucleoprotein homolog (yeast)
domestic guinea pig(100729214) NHP2 ribonucleoprotein
naked mole-rat(101712653) NHP2 ribonucleoprotein
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026631 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026631 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026631 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_017838 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017838 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017838 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001034833 Rosetta Predictions human pricing
NM_017838 Rosetta Predictions human pricing
NM_001105779 Rosetta Predictions rat pricing
NM_026631 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001034833 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00236071 predicted 273
2 SASI_Hs01_00236072 predicted 272
3 SASI_Hs02_00308140 predicted 216
4 SASI_Hs01_00236073 predicted 270
5 SASI_Hs01_00236075 predicted 212
6 SASI_Hs01_00236076 predicted 447
7 SASI_Hs01_00236077 predicted 518
8 SASI_Hs01_00236078 predicted 335
9 SASI_Hs01_00236079 predicted 343
10 SASI_Hs01_00236080 predicted 431
11 SASI_Hs01_00236074 predicted 521
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017838 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00239283 predicted 405
2 SASI_Hs01_00239284 predicted 439
3 SASI_Hs01_00239285 predicted 435
4 SASI_Hs01_00239286 predicted 276
5 SASI_Hs01_00239287 predicted 388
6 SASI_Hs01_00239288 predicted 420
7 SASI_Hs01_00239289 predicted 546
8 SASI_Hs01_00239290 predicted 434
9 SASI_Hs01_00239291 predicted 401
10 SASI_Hs01_00239292 predicted 331
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105779 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00212446 predicted 209
2 SASI_Rn02_00212447 predicted 317
3 SASI_Rn02_00212448 predicted 316
4 SASI_Rn02_00212449 predicted 309
5 SASI_Rn02_00212450 predicted 205
6 SASI_Rn02_00212451 predicted 198
7 SASI_Rn02_00212452 predicted 214
8 SASI_Rn02_00212453 predicted 234
9 SASI_Rn02_00212454 predicted 263
10 SASI_Rn02_00212455 predicted 278
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026631 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00193400 predicted 677
2 SASI_Mm01_00193401 predicted 687
3 SASI_Mm01_00193402 predicted 719
4 SASI_Mm02_00330604 predicted 679
5 SASI_Mm01_00193404 predicted 405
6 SASI_Mm01_00193405 predicted 298
7 SASI_Mm01_00193406 predicted 393
8 SASI_Mm02_00330605 predicted 307
9 SASI_Mm01_00193407 predicted 263
10 SASI_Mm01_00193408 predicted 490
11 SASI_Mm01_00193403 predicted 657
12 SASI_Mm01_00193409 predicted 308
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026631
VALIDATED
NHP2 MISSION shRNA Bacterial Glycerol Stock
NHP2 ribonucleoprotein
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000126279    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026631.1-837s1c1
Sequence:CCGGCCCGTCTTCATTTCCCACTTTCTCGAGAAAGTGGGAAATGAAGACGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026631.1-409s1c1
Sequence:CCGGGCGTCCCACTTGTGTGATCATCTCGAGATGATCACACAAGTGGGACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026631.1-178s1c1
Sequence:CCGGGCGCAAGCTCTACAAGTGCATCTCGAGATGCACTTGTAGAGCTTGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304777    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026631.3-689s21c1
Sequence:CCGGAGAATGTGGGATAGAAGTAAACTCGAGTTTACTTCTATCCCACATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126280    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026631.1-290s1c1
Sequence:CCGGGCAGGAGATACATTGCCGATTCTCGAGAATCGGCAATGTATCTCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026631.1-267s1c1
Sequence:CCGGGCGAGAAAGGGATCATGGTTTCTCGAGAAACCATGATCCCTTTCTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349152    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026631.3-266s21c1
Sequence:CCGGGCGAGAAAGGGATCATGGTTTCTCGAGAAACCATGATCCCTTTCTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316095    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026631.3-289s21c1
Sequence:CCGGGCAGGAGATACATTGCCGATTCTCGAGAATCGGCAATGTATCTCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316169    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026631.3-177s21c1
Sequence:CCGGGCGCAAGCTCTACAAGTGCATCTCGAGATGCACTTGTAGAGCTTGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304778    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026631.3-116s21c1
Sequence:CCGGACAAAGAGCTGCTGGTCAATCCTCGAGGATTGACCAGCAGCTCTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026631
VALIDATED
NHP2 MISSION shRNA shRNA Plasmid DNA
NHP2 ribonucleoprotein
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000126279    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026631.1-837s1c1
Sequence:CCGGCCCGTCTTCATTTCCCACTTTCTCGAGAAAGTGGGAAATGAAGACGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000126281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026631.1-409s1c1
Sequence:CCGGGCGTCCCACTTGTGTGATCATCTCGAGATGATCACACAAGTGGGACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000126282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026631.1-178s1c1
Sequence:CCGGGCGCAAGCTCTACAAGTGCATCTCGAGATGCACTTGTAGAGCTTGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304777    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026631.3-689s21c1
Sequence:CCGGAGAATGTGGGATAGAAGTAAACTCGAGTTTACTTCTATCCCACATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000126280    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026631.1-290s1c1
Sequence:CCGGGCAGGAGATACATTGCCGATTCTCGAGAATCGGCAATGTATCTCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000126283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026631.1-267s1c1
Sequence:CCGGGCGAGAAAGGGATCATGGTTTCTCGAGAAACCATGATCCCTTTCTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000349152    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026631.3-266s21c1
Sequence:CCGGGCGAGAAAGGGATCATGGTTTCTCGAGAAACCATGATCCCTTTCTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000316095    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026631.3-289s21c1
Sequence:CCGGGCAGGAGATACATTGCCGATTCTCGAGAATCGGCAATGTATCTCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000316169    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026631.3-177s21c1
Sequence:CCGGGCGCAAGCTCTACAAGTGCATCTCGAGATGCACTTGTAGAGCTTGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304778    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026631.3-116s21c1
Sequence:CCGGACAAAGAGCTGCTGGTCAATCCTCGAGGATTGACCAGCAGCTCTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026631
VALIDATED
NHP2 MISSION shRNA Lentiviral Transduction Particles
NHP2 ribonucleoprotein
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000126279    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026631.1-837s1c1
Sequence:CCGGCCCGTCTTCATTTCCCACTTTCTCGAGAAAGTGGGAAATGAAGACGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026631.1-409s1c1
Sequence:CCGGGCGTCCCACTTGTGTGATCATCTCGAGATGATCACACAAGTGGGACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026631.1-178s1c1
Sequence:CCGGGCGCAAGCTCTACAAGTGCATCTCGAGATGCACTTGTAGAGCTTGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304777    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026631.3-689s21c1
Sequence:CCGGAGAATGTGGGATAGAAGTAAACTCGAGTTTACTTCTATCCCACATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126280    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026631.1-290s1c1
Sequence:CCGGGCAGGAGATACATTGCCGATTCTCGAGAATCGGCAATGTATCTCCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026631.1-267s1c1
Sequence:CCGGGCGAGAAAGGGATCATGGTTTCTCGAGAAACCATGATCCCTTTCTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349152    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026631.3-266s21c1
Sequence:CCGGGCGAGAAAGGGATCATGGTTTCTCGAGAAACCATGATCCCTTTCTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316095    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026631.3-289s21c1
Sequence:CCGGGCAGGAGATACATTGCCGATTCTCGAGAATCGGCAATGTATCTCCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316169    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026631.3-177s21c1
Sequence:CCGGGCGCAAGCTCTACAAGTGCATCTCGAGATGCACTTGTAGAGCTTGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304778    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026631.3-116s21c1
Sequence:CCGGACAAAGAGCTGCTGGTCAATCCTCGAGGATTGACCAGCAGCTCTTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017838
VALIDATED
NHP2 MISSION shRNA Bacterial Glycerol Stock
NHP2 ribonucleoprotein
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000072540    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_017838.3-402s1c1
Sequence:CCGGCCCATTGAGGTATACTGCCATCTCGAGATGGCAGTATACCTCAATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072542    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_017838.3-271s1c1
Sequence:CCGGTCACGCGGAAGCTCTACAAATCTCGAGATTTGTAGAGCTTCCGCGTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072539    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_017838.3-429s1c1
Sequence:CCGGGTCATGTGTGAGGACCGAAATCTCGAGATTTCGGTCCTCACACATGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072541    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_017838.3-278s1c1
Sequence:CCGGGAAGCTCTACAAATGCATCAACTCGAGTTGATGCATTTGTAGAGCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286135    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017838.3-278s21c1
Sequence:CCGGGAAGCTCTACAAATGCATCAACTCGAGTTGATGCATTTGTAGAGCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286134    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017838.3-429s21c1
Sequence:CCGGGTCATGTGTGAGGACCGAAATCTCGAGATTTCGGTCCTCACACATGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293212    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017838.3-304s21c1
Sequence:CCGGCGGTGAAGCAGAAGCAGATTCCTCGAGGAATCTGCTTCTGCTTCACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286133    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017838.3-402s21c1
Sequence:CCGGCCCATTGAGGTATACTGCCATCTCGAGATGGCAGTATACCTCAATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293213    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017838.3-628s21c1
Sequence:CCGGACCTGCCGCTGGAAGCTATTGCTCGAGCAATAGCTTCCAGCGGCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017838
VALIDATED
NHP2 MISSION shRNA shRNA Plasmid DNA
NHP2 ribonucleoprotein
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000072540    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_017838.3-402s1c1
Sequence:CCGGCCCATTGAGGTATACTGCCATCTCGAGATGGCAGTATACCTCAATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072542    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_017838.3-271s1c1
Sequence:CCGGTCACGCGGAAGCTCTACAAATCTCGAGATTTGTAGAGCTTCCGCGTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072539    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_017838.3-429s1c1
Sequence:CCGGGTCATGTGTGAGGACCGAAATCTCGAGATTTCGGTCCTCACACATGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072541    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_017838.3-278s1c1
Sequence:CCGGGAAGCTCTACAAATGCATCAACTCGAGTTGATGCATTTGTAGAGCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286135    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017838.3-278s21c1
Sequence:CCGGGAAGCTCTACAAATGCATCAACTCGAGTTGATGCATTTGTAGAGCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286134    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017838.3-429s21c1
Sequence:CCGGGTCATGTGTGAGGACCGAAATCTCGAGATTTCGGTCCTCACACATGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293212    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017838.3-304s21c1
Sequence:CCGGCGGTGAAGCAGAAGCAGATTCCTCGAGGAATCTGCTTCTGCTTCACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286133    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017838.3-402s21c1
Sequence:CCGGCCCATTGAGGTATACTGCCATCTCGAGATGGCAGTATACCTCAATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293213    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017838.3-628s21c1
Sequence:CCGGACCTGCCGCTGGAAGCTATTGCTCGAGCAATAGCTTCCAGCGGCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017838
VALIDATED
NHP2 MISSION shRNA Lentiviral Transduction Particles
NHP2 ribonucleoprotein
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000072540    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_017838.3-402s1c1
Sequence:CCGGCCCATTGAGGTATACTGCCATCTCGAGATGGCAGTATACCTCAATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072542    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_017838.3-271s1c1
Sequence:CCGGTCACGCGGAAGCTCTACAAATCTCGAGATTTGTAGAGCTTCCGCGTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072539    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_017838.3-429s1c1
Sequence:CCGGGTCATGTGTGAGGACCGAAATCTCGAGATTTCGGTCCTCACACATGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072541    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_017838.3-278s1c1
Sequence:CCGGGAAGCTCTACAAATGCATCAACTCGAGTTGATGCATTTGTAGAGCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286135    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017838.3-278s21c1
Sequence:CCGGGAAGCTCTACAAATGCATCAACTCGAGTTGATGCATTTGTAGAGCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286134    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017838.3-429s21c1
Sequence:CCGGGTCATGTGTGAGGACCGAAATCTCGAGATTTCGGTCCTCACACATGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293212    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017838.3-304s21c1
Sequence:CCGGCGGTGAAGCAGAAGCAGATTCCTCGAGGAATCTGCTTCTGCTTCACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286133    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017838.3-402s21c1
Sequence:CCGGCCCATTGAGGTATACTGCCATCTCGAGATGGCAGTATACCTCAATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293213    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017838.3-628s21c1
Sequence:CCGGACCTGCCGCTGGAAGCTATTGCTCGAGCAATAGCTTCCAGCGGCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)